Incidental Mutation 'R5006:Wls'
ID 390160
Institutional Source Beutler Lab
Gene Symbol Wls
Ensembl Gene ENSMUSG00000028173
Gene Name wntless WNT ligand secretion mediator
Synonyms 5031439A09Rik, Gpr177
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R5006 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 159839672-159938664 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 159911791 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 368 (I368V)
Ref Sequence ENSEMBL: ENSMUSP00000143475 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068952] [ENSMUST00000198878] [ENSMUST00000200191]
AlphaFold Q6DID7
Predicted Effect possibly damaging
Transcript: ENSMUST00000068952
AA Change: I368V

PolyPhen 2 Score 0.684 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000067898
Gene: ENSMUSG00000028173
AA Change: I368V

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 36 47 N/A INTRINSIC
Pfam:MIG-14_Wnt-bd 178 496 3.7e-97 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000101953
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197328
Predicted Effect possibly damaging
Transcript: ENSMUST00000198878
AA Change: I368V

PolyPhen 2 Score 0.684 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000143475
Gene: ENSMUSG00000028173
AA Change: I368V

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 36 47 N/A INTRINSIC
Pfam:MIG-14_Wnt-bd 177 497 2.8e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200191
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200571
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for null alleles exhibit impaired body axis and triploblastic development dying prior to E10.5. Mice homozygous for a floxed allele activated in keratinocytes exhibit a psoriasiform dermatitis-like phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf2 C A 5: 24,576,537 E51* probably null Het
Bcl11a T A 11: 24,164,989 Y777* probably null Het
C2cd4c T A 10: 79,612,507 T269S probably benign Het
Fam96a G A 9: 66,136,352 probably null Het
Foxp1 A C 6: 99,162,858 V54G probably damaging Het
Gm11639 T A 11: 104,729,677 probably null Het
Il2ra T G 2: 11,674,346 L39R possibly damaging Het
Klk1b9 A T 7: 43,979,287 K72* probably null Het
Lmo7 A G 14: 101,926,237 probably benign Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Nebl T A 2: 17,388,771 probably null Het
Olfr711 C T 7: 106,971,601 V248I probably damaging Het
Olfr849 A G 9: 19,441,249 N112S probably benign Het
Olfr860 G T 9: 19,846,271 A116E probably benign Het
Ralgapa1 A T 12: 55,718,114 C918S probably benign Het
Rasd2 G T 8: 75,218,606 R21L probably damaging Het
Sema4a A G 3: 88,436,784 M720T probably benign Het
Susd3 A G 13: 49,238,705 probably benign Het
Vmn1r235 T C 17: 21,262,205 M264T probably benign Het
Ypel4 A G 2: 84,736,838 D5G probably benign Het
Zbtb38 C T 9: 96,685,651 G1127S probably damaging Het
Other mutations in Wls
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01924:Wls APN 3 159901443 nonsense probably null
IGL02065:Wls APN 3 159911356 missense probably damaging 0.99
IGL02073:Wls APN 3 159907253 critical splice donor site probably null
IGL02133:Wls APN 3 159897370 missense probably damaging 1.00
R0374:Wls UTSW 3 159897437 nonsense probably null
R0561:Wls UTSW 3 159873068 missense probably benign 0.32
R1697:Wls UTSW 3 159897358 missense probably benign 0.12
R1791:Wls UTSW 3 159911813 missense probably benign 0.17
R2444:Wls UTSW 3 159907230 missense probably damaging 1.00
R3161:Wls UTSW 3 159897436 missense probably damaging 1.00
R4285:Wls UTSW 3 159934266 missense probably benign
R4468:Wls UTSW 3 159872927 missense probably damaging 0.96
R4472:Wls UTSW 3 159897383 missense probably benign 0.01
R4782:Wls UTSW 3 159897445 missense probably benign 0.03
R4799:Wls UTSW 3 159897445 missense probably benign 0.03
R4809:Wls UTSW 3 159897445 missense probably benign 0.03
R5212:Wls UTSW 3 159873008 missense probably benign 0.15
R5434:Wls UTSW 3 159934340 missense probably damaging 0.97
R5694:Wls UTSW 3 159839987 missense probably benign 0.01
R6315:Wls UTSW 3 159934371 critical splice donor site probably null
R7069:Wls UTSW 3 159934329 missense probably damaging 1.00
R7243:Wls UTSW 3 159909765 missense possibly damaging 0.49
R7529:Wls UTSW 3 159873007 missense probably benign 0.43
R7697:Wls UTSW 3 159911318 missense probably benign 0.21
R7842:Wls UTSW 3 159873179 missense probably benign 0.09
R8136:Wls UTSW 3 159873124 missense probably damaging 1.00
R8536:Wls UTSW 3 159873111 missense probably damaging 0.96
R8816:Wls UTSW 3 159934292 missense possibly damaging 0.89
R9074:Wls UTSW 3 159909766 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- GCTTGCCATATTCTAAAGCTCTG -3'
(R):5'- CCACTTTGGGTGCTTTCACAG -3'

Sequencing Primer
(F):5'- GCCATATTCTAAAGCTCTGCATCTC -3'
(R):5'- ATCCTATTAGTCTGAGGATCAGGG -3'
Posted On 2016-06-06