Incidental Mutation 'R5006:Abcf2'
ID390162
Institutional Source Beutler Lab
Gene Symbol Abcf2
Ensembl Gene ENSMUSG00000028953
Gene NameATP-binding cassette, sub-family F (GCN20), member 2
Synonyms0710005O05Rik, Drr3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.230) question?
Stock #R5006 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location24565345-24577467 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 24576537 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 51 (E51*)
Ref Sequence ENSEMBL: ENSMUSP00000030795 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030795]
Predicted Effect probably null
Transcript: ENSMUST00000030795
AA Change: E51*
SMART Domains Protein: ENSMUSP00000030795
Gene: ENSMUSG00000028953
AA Change: E51*

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
AAA 115 308 1.6e-6 SMART
AAA 427 595 6.32e-5 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ATP-binding cassette (ABC) transporter superfamily. ATP-binding casette proteins transport various molecules across extra- and intracellular membranes. Alterations in this gene may be involved in cancer progression. Alternative splicing results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 3 and 7. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bcl11a T A 11: 24,164,989 Y777* probably null Het
C2cd4c T A 10: 79,612,507 T269S probably benign Het
Fam96a G A 9: 66,136,352 probably null Het
Foxp1 A C 6: 99,162,858 V54G probably damaging Het
Gm11639 T A 11: 104,729,677 probably null Het
Il2ra T G 2: 11,674,346 L39R possibly damaging Het
Klk1b9 A T 7: 43,979,287 K72* probably null Het
Lmo7 A G 14: 101,926,237 probably benign Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Nebl T A 2: 17,388,771 probably null Het
Olfr711 C T 7: 106,971,601 V248I probably damaging Het
Olfr849 A G 9: 19,441,249 N112S probably benign Het
Olfr860 G T 9: 19,846,271 A116E probably benign Het
Ralgapa1 A T 12: 55,718,114 C918S probably benign Het
Rasd2 G T 8: 75,218,606 R21L probably damaging Het
Sema4a A G 3: 88,436,784 M720T probably benign Het
Susd3 A G 13: 49,238,705 probably benign Het
Vmn1r235 T C 17: 21,262,205 M264T probably benign Het
Wls A G 3: 159,911,791 I368V possibly damaging Het
Ypel4 A G 2: 84,736,838 D5G probably benign Het
Zbtb38 C T 9: 96,685,651 G1127S probably damaging Het
Other mutations in Abcf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00579:Abcf2 APN 5 24568796 missense possibly damaging 0.95
IGL02867:Abcf2 APN 5 24571151 missense probably benign 0.03
IGL03325:Abcf2 APN 5 24574212 missense probably damaging 1.00
IGL03329:Abcf2 APN 5 24571248 critical splice acceptor site probably null
R0281:Abcf2 UTSW 5 24566564 missense probably damaging 1.00
R0357:Abcf2 UTSW 5 24573465 missense probably benign 0.16
R0815:Abcf2 UTSW 5 24567270 missense probably damaging 1.00
R0835:Abcf2 UTSW 5 24574253 missense probably damaging 0.99
R1793:Abcf2 UTSW 5 24568776 missense probably benign
R2321:Abcf2 UTSW 5 24567253 nonsense probably null
R5765:Abcf2 UTSW 5 24573423 missense probably damaging 0.99
R6317:Abcf2 UTSW 5 24569158 nonsense probably null
R6684:Abcf2 UTSW 5 24569139 missense probably damaging 1.00
R6906:Abcf2 UTSW 5 24568842 missense possibly damaging 0.90
R6980:Abcf2 UTSW 5 24565972 missense probably benign 0.01
R8266:Abcf2 UTSW 5 24576591 small insertion probably benign
R8267:Abcf2 UTSW 5 24576591 small insertion probably benign
R8290:Abcf2 UTSW 5 24576591 small insertion probably benign
R8294:Abcf2 UTSW 5 24576591 small insertion probably benign
R8295:Abcf2 UTSW 5 24576591 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- CTGTGTTTGCCACTTGAATTCAG -3'
(R):5'- AACTACCCCTGTGGCTCATC -3'

Sequencing Primer
(F):5'- GGTGTCACCAAAAAGTTTCATGGC -3'
(R):5'- GTGGCTCATCACCATGCC -3'
Posted On2016-06-06