Incidental Mutation 'R5006:Foxp1'
ID 390163
Institutional Source Beutler Lab
Gene Symbol Foxp1
Ensembl Gene ENSMUSG00000030067
Gene Name forkhead box P1
Synonyms 4932443N09Rik, 3110052D19Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R5006 (G1)
Quality Score 223
Status Not validated
Chromosome 6
Chromosomal Location 98925338-99522721 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 99162858 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 54 (V54G)
Ref Sequence ENSEMBL: ENSMUSP00000108952 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074346] [ENSMUST00000113322] [ENSMUST00000113324] [ENSMUST00000113326] [ENSMUST00000113328] [ENSMUST00000113329] [ENSMUST00000176565] [ENSMUST00000176632] [ENSMUST00000176850] [ENSMUST00000177208] [ENSMUST00000177227] [ENSMUST00000177230] [ENSMUST00000177307]
AlphaFold P58462
Predicted Effect probably benign
Transcript: ENSMUST00000074346
AA Change: V54G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000073953
Gene: ENSMUSG00000030067
AA Change: V54G

DomainStartEndE-ValueType
coiled coil region 62 113 N/A INTRINSIC
low complexity region 140 191 N/A INTRINSIC
low complexity region 200 233 N/A INTRINSIC
low complexity region 236 250 N/A INTRINSIC
low complexity region 264 275 N/A INTRINSIC
low complexity region 317 330 N/A INTRINSIC
ZnF_C2H2 334 359 8.67e-1 SMART
low complexity region 371 383 N/A INTRINSIC
low complexity region 432 446 N/A INTRINSIC
FH 491 572 2.07e-39 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000075832
Predicted Effect probably benign
Transcript: ENSMUST00000113322
AA Change: V54G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108948
Gene: ENSMUSG00000030067
AA Change: V54G

DomainStartEndE-ValueType
coiled coil region 62 113 N/A INTRINSIC
low complexity region 140 191 N/A INTRINSIC
low complexity region 200 233 N/A INTRINSIC
low complexity region 236 250 N/A INTRINSIC
low complexity region 264 275 N/A INTRINSIC
low complexity region 317 330 N/A INTRINSIC
ZnF_C2H2 334 359 8.67e-1 SMART
low complexity region 371 383 N/A INTRINSIC
low complexity region 432 446 N/A INTRINSIC
FH 491 572 2.07e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113324
AA Change: V54G

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000108950
Gene: ENSMUSG00000030067
AA Change: V54G

DomainStartEndE-ValueType
coiled coil region 62 113 N/A INTRINSIC
low complexity region 140 192 N/A INTRINSIC
low complexity region 201 234 N/A INTRINSIC
low complexity region 237 251 N/A INTRINSIC
low complexity region 265 276 N/A INTRINSIC
low complexity region 318 331 N/A INTRINSIC
ZnF_C2H2 335 360 8.67e-1 SMART
low complexity region 372 384 N/A INTRINSIC
low complexity region 433 447 N/A INTRINSIC
FH 492 573 2.07e-39 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113326
AA Change: V54G

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108952
Gene: ENSMUSG00000030067
AA Change: V54G

DomainStartEndE-ValueType
low complexity region 108 159 N/A INTRINSIC
low complexity region 168 201 N/A INTRINSIC
low complexity region 204 218 N/A INTRINSIC
low complexity region 232 243 N/A INTRINSIC
low complexity region 285 298 N/A INTRINSIC
ZnF_C2H2 302 327 8.67e-1 SMART
low complexity region 339 351 N/A INTRINSIC
low complexity region 400 414 N/A INTRINSIC
FH 459 540 2.07e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113328
AA Change: V54G

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000108954
Gene: ENSMUSG00000030067
AA Change: V54G

DomainStartEndE-ValueType
coiled coil region 62 113 N/A INTRINSIC
low complexity region 140 191 N/A INTRINSIC
low complexity region 200 234 N/A INTRINSIC
low complexity region 237 251 N/A INTRINSIC
low complexity region 265 276 N/A INTRINSIC
low complexity region 318 331 N/A INTRINSIC
ZnF_C2H2 335 360 8.67e-1 SMART
low complexity region 372 384 N/A INTRINSIC
low complexity region 433 447 N/A INTRINSIC
FH 492 573 2.07e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113329
AA Change: V54G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108955
Gene: ENSMUSG00000030067
AA Change: V54G

DomainStartEndE-ValueType
coiled coil region 62 113 N/A INTRINSIC
low complexity region 140 191 N/A INTRINSIC
low complexity region 200 233 N/A INTRINSIC
low complexity region 236 250 N/A INTRINSIC
low complexity region 264 275 N/A INTRINSIC
low complexity region 317 330 N/A INTRINSIC
ZnF_C2H2 334 359 8.67e-1 SMART
low complexity region 371 383 N/A INTRINSIC
low complexity region 432 446 N/A INTRINSIC
FH 491 579 1.76e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131967
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138754
Predicted Effect possibly damaging
Transcript: ENSMUST00000176565
AA Change: V54G

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000135181
Gene: ENSMUSG00000030067
AA Change: V54G

DomainStartEndE-ValueType
coiled coil region 62 113 N/A INTRINSIC
low complexity region 140 191 N/A INTRINSIC
low complexity region 200 234 N/A INTRINSIC
low complexity region 237 251 N/A INTRINSIC
low complexity region 265 276 N/A INTRINSIC
low complexity region 318 331 N/A INTRINSIC
ZnF_C2H2 335 360 8.67e-1 SMART
low complexity region 372 384 N/A INTRINSIC
low complexity region 433 447 N/A INTRINSIC
FH 491 572 2.07e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176632
AA Change: V54G

PolyPhen 2 Score 0.267 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000135635
Gene: ENSMUSG00000030067
AA Change: V54G

DomainStartEndE-ValueType
low complexity region 108 159 N/A INTRINSIC
low complexity region 168 202 N/A INTRINSIC
low complexity region 205 219 N/A INTRINSIC
low complexity region 233 244 N/A INTRINSIC
low complexity region 286 299 N/A INTRINSIC
ZnF_C2H2 303 328 8.67e-1 SMART
low complexity region 340 352 N/A INTRINSIC
low complexity region 401 415 N/A INTRINSIC
FH 460 541 2.07e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176850
AA Change: V54G

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000135041
Gene: ENSMUSG00000030067
AA Change: V54G

DomainStartEndE-ValueType
low complexity region 108 160 N/A INTRINSIC
low complexity region 169 203 N/A INTRINSIC
low complexity region 206 220 N/A INTRINSIC
low complexity region 234 245 N/A INTRINSIC
low complexity region 287 300 N/A INTRINSIC
ZnF_C2H2 304 329 8.67e-1 SMART
low complexity region 341 353 N/A INTRINSIC
low complexity region 402 416 N/A INTRINSIC
FH 461 542 2.07e-39 SMART
Predicted Effect unknown
Transcript: ENSMUST00000177208
AA Change: V54G
SMART Domains Protein: ENSMUSP00000135187
Gene: ENSMUSG00000030067
AA Change: V54G

DomainStartEndE-ValueType
coiled coil region 62 88 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177227
Predicted Effect probably benign
Transcript: ENSMUST00000177230
AA Change: V54G

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000135098
Gene: ENSMUSG00000030067
AA Change: V54G

DomainStartEndE-ValueType
low complexity region 108 160 N/A INTRINSIC
low complexity region 169 203 N/A INTRINSIC
low complexity region 206 220 N/A INTRINSIC
low complexity region 234 245 N/A INTRINSIC
low complexity region 287 300 N/A INTRINSIC
ZnF_C2H2 304 329 8.67e-1 SMART
low complexity region 341 353 N/A INTRINSIC
low complexity region 402 416 N/A INTRINSIC
FH 461 542 2.07e-39 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000177307
AA Change: V54G

PolyPhen 2 Score 0.838 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000135764
Gene: ENSMUSG00000030067
AA Change: V54G

DomainStartEndE-ValueType
coiled coil region 62 113 N/A INTRINSIC
low complexity region 140 192 N/A INTRINSIC
low complexity region 201 235 N/A INTRINSIC
low complexity region 238 252 N/A INTRINSIC
low complexity region 266 277 N/A INTRINSIC
low complexity region 319 332 N/A INTRINSIC
ZnF_C2H2 336 361 8.67e-1 SMART
low complexity region 373 385 N/A INTRINSIC
low complexity region 434 448 N/A INTRINSIC
FH 492 573 2.07e-39 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice display embryonic lethality with abnormal outflow tract septation, ventricular septal defects, abnormal cardiac valve morphology, decreased and irregular heart rate, thin ventricular compact zone, and edema. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf2 C A 5: 24,576,537 E51* probably null Het
Bcl11a T A 11: 24,164,989 Y777* probably null Het
C2cd4c T A 10: 79,612,507 T269S probably benign Het
Fam96a G A 9: 66,136,352 probably null Het
Gm11639 T A 11: 104,729,677 probably null Het
Il2ra T G 2: 11,674,346 L39R possibly damaging Het
Klk1b9 A T 7: 43,979,287 K72* probably null Het
Lmo7 A G 14: 101,926,237 probably benign Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Nebl T A 2: 17,388,771 probably null Het
Olfr711 C T 7: 106,971,601 V248I probably damaging Het
Olfr849 A G 9: 19,441,249 N112S probably benign Het
Olfr860 G T 9: 19,846,271 A116E probably benign Het
Ralgapa1 A T 12: 55,718,114 C918S probably benign Het
Rasd2 G T 8: 75,218,606 R21L probably damaging Het
Sema4a A G 3: 88,436,784 M720T probably benign Het
Susd3 A G 13: 49,238,705 probably benign Het
Vmn1r235 T C 17: 21,262,205 M264T probably benign Het
Wls A G 3: 159,911,791 I368V possibly damaging Het
Ypel4 A G 2: 84,736,838 D5G probably benign Het
Zbtb38 C T 9: 96,685,651 G1127S probably damaging Het
Other mutations in Foxp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02191:Foxp1 APN 6 98945600 missense probably damaging 0.99
IGL02330:Foxp1 APN 6 98945412 missense probably damaging 1.00
IGL02869:Foxp1 APN 6 98930083 utr 3 prime probably benign
IGL02968:Foxp1 APN 6 99075861 missense probably damaging 1.00
Foxy UTSW 6 99015510 nonsense probably null
Moxie UTSW 6 99015514 critical splice acceptor site probably null
Roxie UTSW 6 98941634 missense unknown
R0037:Foxp1 UTSW 6 99162969 missense probably damaging 1.00
R0063:Foxp1 UTSW 6 98944723 splice site probably benign
R0063:Foxp1 UTSW 6 98944723 splice site probably benign
R0427:Foxp1 UTSW 6 98930203 missense probably damaging 1.00
R0601:Foxp1 UTSW 6 98930122 missense probably damaging 1.00
R1356:Foxp1 UTSW 6 99016676 splice site probably benign
R1468:Foxp1 UTSW 6 98978220 missense possibly damaging 0.62
R1468:Foxp1 UTSW 6 98978220 missense possibly damaging 0.62
R1548:Foxp1 UTSW 6 98945420 missense probably damaging 1.00
R1696:Foxp1 UTSW 6 98945702 missense probably benign 0.18
R1933:Foxp1 UTSW 6 99075965 small deletion probably benign
R2152:Foxp1 UTSW 6 99016541 missense probably damaging 0.99
R2338:Foxp1 UTSW 6 99003293 missense possibly damaging 0.61
R3896:Foxp1 UTSW 6 99075936 missense probably benign 0.33
R5143:Foxp1 UTSW 6 98945532 critical splice donor site probably null
R5428:Foxp1 UTSW 6 99016631 missense probably damaging 1.00
R5765:Foxp1 UTSW 6 99015462 missense probably damaging 0.99
R5816:Foxp1 UTSW 6 99075965 small deletion probably benign
R6172:Foxp1 UTSW 6 99015510 nonsense probably null
R6172:Foxp1 UTSW 6 99015514 critical splice acceptor site probably null
R6173:Foxp1 UTSW 6 99015510 nonsense probably null
R6173:Foxp1 UTSW 6 99015514 critical splice acceptor site probably null
R6175:Foxp1 UTSW 6 98966076 missense probably damaging 1.00
R6776:Foxp1 UTSW 6 99075965 small deletion probably benign
R6782:Foxp1 UTSW 6 98930145 missense probably damaging 1.00
R7229:Foxp1 UTSW 6 98935412 missense unknown
R7559:Foxp1 UTSW 6 98945560 missense unknown
R7715:Foxp1 UTSW 6 98945660 missense unknown
R8007:Foxp1 UTSW 6 98941634 missense unknown
R8099:Foxp1 UTSW 6 98945549 missense unknown
R8317:Foxp1 UTSW 6 99075905 small deletion probably benign
R8408:Foxp1 UTSW 6 98945582 missense unknown
R8704:Foxp1 UTSW 6 99016546 missense unknown
R8705:Foxp1 UTSW 6 99016546 missense unknown
R9014:Foxp1 UTSW 6 99075905 small deletion probably benign
R9147:Foxp1 UTSW 6 99075905 small deletion probably benign
R9399:Foxp1 UTSW 6 99075905 small deletion probably benign
R9604:Foxp1 UTSW 6 99075965 small deletion probably benign
X0066:Foxp1 UTSW 6 99076015 nonsense probably null
Z1177:Foxp1 UTSW 6 98978161 missense unknown
Predicted Primers PCR Primer
(F):5'- GCTCAAGGTTCATTCAACTCCAAG -3'
(R):5'- TTCTGGAAATCCTTCTCTCAGG -3'

Sequencing Primer
(F):5'- TAACAGTCACTCTCTTCGGAAGG -3'
(R):5'- GAAATCCTTCTCTCAGGTTTTTGAG -3'
Posted On 2016-06-06