Incidental Mutation 'R5006:Olfr711'
ID 390165
Institutional Source Beutler Lab
Gene Symbol Olfr711
Ensembl Gene ENSMUSG00000045013
Gene Name olfactory receptor 711
Synonyms GA_x6K02T2PBJ9-9352783-9351839, MOR103-4
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock # R5006 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 106969694-106975453 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 106971601 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 248 (V248I)
Ref Sequence ENSEMBL: ENSMUSP00000149016 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051715] [ENSMUST00000207200] [ENSMUST00000216335]
AlphaFold Q9EPG2
Predicted Effect probably damaging
Transcript: ENSMUST00000051715
AA Change: V248I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055724
Gene: ENSMUSG00000045013
AA Change: V248I

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.5e-58 PFAM
Pfam:7tm_1 41 290 1.2e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000207200
AA Change: V248I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000216335
AA Change: V248I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf2 C A 5: 24,576,537 E51* probably null Het
Bcl11a T A 11: 24,164,989 Y777* probably null Het
C2cd4c T A 10: 79,612,507 T269S probably benign Het
Fam96a G A 9: 66,136,352 probably null Het
Foxp1 A C 6: 99,162,858 V54G probably damaging Het
Gm11639 T A 11: 104,729,677 probably null Het
Il2ra T G 2: 11,674,346 L39R possibly damaging Het
Klk1b9 A T 7: 43,979,287 K72* probably null Het
Lmo7 A G 14: 101,926,237 probably benign Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Nebl T A 2: 17,388,771 probably null Het
Olfr849 A G 9: 19,441,249 N112S probably benign Het
Olfr860 G T 9: 19,846,271 A116E probably benign Het
Ralgapa1 A T 12: 55,718,114 C918S probably benign Het
Rasd2 G T 8: 75,218,606 R21L probably damaging Het
Sema4a A G 3: 88,436,784 M720T probably benign Het
Susd3 A G 13: 49,238,705 probably benign Het
Vmn1r235 T C 17: 21,262,205 M264T probably benign Het
Wls A G 3: 159,911,791 I368V possibly damaging Het
Ypel4 A G 2: 84,736,838 D5G probably benign Het
Zbtb38 C T 9: 96,685,651 G1127S probably damaging Het
Other mutations in Olfr711
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02600:Olfr711 APN 7 106971549 missense possibly damaging 0.51
R0087:Olfr711 UTSW 7 106972116 missense probably benign 0.01
R0580:Olfr711 UTSW 7 106972240 missense probably damaging 1.00
R1375:Olfr711 UTSW 7 106972098 missense probably damaging 1.00
R1538:Olfr711 UTSW 7 106971983 nonsense probably null
R1875:Olfr711 UTSW 7 106972182 missense possibly damaging 0.86
R2156:Olfr711 UTSW 7 106971568 missense probably damaging 1.00
R4290:Olfr711 UTSW 7 106971711 missense probably damaging 0.97
R4332:Olfr711 UTSW 7 106972147 missense probably benign 0.00
R4400:Olfr711 UTSW 7 106972002 missense probably damaging 1.00
R4688:Olfr711 UTSW 7 106971861 missense probably benign 0.02
R4868:Olfr711 UTSW 7 106971767 missense probably benign
R4970:Olfr711 UTSW 7 106971571 missense probably benign 0.35
R5082:Olfr711 UTSW 7 106971664 missense probably benign 0.00
R5121:Olfr711 UTSW 7 106972231 missense probably benign
R6465:Olfr711 UTSW 7 106972212 missense possibly damaging 0.63
R6541:Olfr711 UTSW 7 106972203 missense probably benign 0.20
R7419:Olfr711 UTSW 7 106972146 missense probably benign 0.01
R8048:Olfr711 UTSW 7 106972464 start gained probably benign
R9310:Olfr711 UTSW 7 106971471 missense probably damaging 1.00
R9470:Olfr711 UTSW 7 106972254 missense probably benign 0.26
R9603:Olfr711 UTSW 7 106971896 nonsense probably null
Z1177:Olfr711 UTSW 7 106971915 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTTCTCAGGGCAAAGGGATC -3'
(R):5'- ATGCAAAGATATGTCCACAGCTG -3'

Sequencing Primer
(F):5'- AGGAAGCACTGGCCACCTC -3'
(R):5'- CCACAGCTGAGCTAGTAGACTTTG -3'
Posted On 2016-06-06