Incidental Mutation 'R5006:Olfr860'
ID 390168
Institutional Source Beutler Lab
Gene Symbol Olfr860
Ensembl Gene ENSMUSG00000066905
Gene Name olfactory receptor 860
Synonyms MOR146-2, GA_x6K02T2PVTD-13586614-13585661
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock # R5006 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 19845156-19849747 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 19846271 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Glutamic Acid at position 116 (A116E)
Ref Sequence ENSEMBL: ENSMUSP00000148658 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086482] [ENSMUST00000211924] [ENSMUST00000212353]
AlphaFold Q8VFF7
Predicted Effect probably benign
Transcript: ENSMUST00000086482
AA Change: A116E

PolyPhen 2 Score 0.275 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000130735
Gene: ENSMUSG00000066905
AA Change: A116E

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.5e-56 PFAM
Pfam:7TM_GPCR_Srsx 35 305 1.1e-8 PFAM
Pfam:7tm_1 41 290 9.3e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211924
AA Change: A116E

PolyPhen 2 Score 0.334 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000212353
AA Change: A116E

PolyPhen 2 Score 0.275 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212525
AA Change: A116E
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212838
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf2 C A 5: 24,576,537 E51* probably null Het
Bcl11a T A 11: 24,164,989 Y777* probably null Het
C2cd4c T A 10: 79,612,507 T269S probably benign Het
Fam96a G A 9: 66,136,352 probably null Het
Foxp1 A C 6: 99,162,858 V54G probably damaging Het
Gm11639 T A 11: 104,729,677 probably null Het
Il2ra T G 2: 11,674,346 L39R possibly damaging Het
Klk1b9 A T 7: 43,979,287 K72* probably null Het
Lmo7 A G 14: 101,926,237 probably benign Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Nebl T A 2: 17,388,771 probably null Het
Olfr711 C T 7: 106,971,601 V248I probably damaging Het
Olfr849 A G 9: 19,441,249 N112S probably benign Het
Ralgapa1 A T 12: 55,718,114 C918S probably benign Het
Rasd2 G T 8: 75,218,606 R21L probably damaging Het
Sema4a A G 3: 88,436,784 M720T probably benign Het
Susd3 A G 13: 49,238,705 probably benign Het
Vmn1r235 T C 17: 21,262,205 M264T probably benign Het
Wls A G 3: 159,911,791 I368V possibly damaging Het
Ypel4 A G 2: 84,736,838 D5G probably benign Het
Zbtb38 C T 9: 96,685,651 G1127S probably damaging Het
Other mutations in Olfr860
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Olfr860 APN 9 19846259 missense probably damaging 1.00
IGL02216:Olfr860 APN 9 19846565 missense probably damaging 0.99
IGL02269:Olfr860 APN 9 19845728 missense possibly damaging 0.85
IGL02964:Olfr860 APN 9 19846254 nonsense probably null
R0042:Olfr860 UTSW 9 19845779 missense probably benign
R1505:Olfr860 UTSW 9 19845788 missense probably benign 0.39
R1941:Olfr860 UTSW 9 19845950 missense probably damaging 0.99
R2030:Olfr860 UTSW 9 19846413 missense probably benign 0.30
R3150:Olfr860 UTSW 9 19846214 missense possibly damaging 0.80
R4597:Olfr860 UTSW 9 19845691 missense probably benign 0.01
R5004:Olfr860 UTSW 9 19846102 missense probably benign 0.00
R5350:Olfr860 UTSW 9 19846616 start codon destroyed probably null 0.97
R6163:Olfr860 UTSW 9 19845728 missense probably benign 0.45
R6368:Olfr860 UTSW 9 19846409 missense probably damaging 1.00
R7206:Olfr860 UTSW 9 19846560 missense probably damaging 0.99
R7315:Olfr860 UTSW 9 19845835 missense probably damaging 0.99
R8195:Olfr860 UTSW 9 19846484 missense probably damaging 0.99
R8537:Olfr860 UTSW 9 19846552 missense probably damaging 0.96
R8546:Olfr860 UTSW 9 19846389 missense probably damaging 0.99
R8803:Olfr860 UTSW 9 19846166 missense possibly damaging 0.95
R9049:Olfr860 UTSW 9 19845749 missense probably damaging 1.00
R9164:Olfr860 UTSW 9 19846208 missense possibly damaging 0.73
R9254:Olfr860 UTSW 9 19845916 missense possibly damaging 0.83
R9379:Olfr860 UTSW 9 19845916 missense possibly damaging 0.83
R9513:Olfr860 UTSW 9 19846520 missense possibly damaging 0.73
R9515:Olfr860 UTSW 9 19846520 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- GGCAAGTTTTAGAAGCTCTGGAAC -3'
(R):5'- TCCACAGCCCAATGTACTTC -3'

Sequencing Primer
(F):5'- TTAGAAGCTCTGGAACATCACAG -3'
(R):5'- GCCCAATGTACTTCTTCCTCTACAAC -3'
Posted On 2016-06-06