Incidental Mutation 'R0436:Zdhhc17'
ID39017
Institutional Source Beutler Lab
Gene Symbol Zdhhc17
Ensembl Gene ENSMUSG00000035798
Gene Namezinc finger, DHHC domain containing 17
SynonymsHip14, A230053P19Rik, D130071N24Rik
MMRRC Submission 038637-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0436 (G1)
Quality Score178
Status Validated
Chromosome10
Chromosomal Location110941780-111010140 bp(-) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) A to T at 110981990 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041723] [ENSMUST00000219307]
Predicted Effect probably null
Transcript: ENSMUST00000041723
SMART Domains Protein: ENSMUSP00000043279
Gene: ENSMUSG00000035798

DomainStartEndE-ValueType
Blast:ANK 57 85 2e-8 BLAST
ANK 89 118 6.71e-2 SMART
ANK 123 152 1.99e-4 SMART
ANK 156 185 1.61e-4 SMART
ANK 189 219 1.9e-1 SMART
ANK 224 253 1.53e-5 SMART
Blast:ANK 257 286 2e-11 BLAST
transmembrane domain 305 323 N/A INTRINSIC
transmembrane domain 328 350 N/A INTRINSIC
transmembrane domain 357 379 N/A INTRINSIC
transmembrane domain 384 403 N/A INTRINSIC
Pfam:zf-DHHC 434 570 1e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000099285
SMART Domains Protein: ENSMUSP00000096889
Gene: ENSMUSG00000035798

DomainStartEndE-ValueType
ANK 79 108 6.71e-2 SMART
ANK 113 142 1.99e-4 SMART
ANK 146 175 1.61e-4 SMART
ANK 179 209 1.9e-1 SMART
ANK 214 243 1.53e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217698
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217793
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218981
Predicted Effect probably null
Transcript: ENSMUST00000219307
Predicted Effect probably benign
Transcript: ENSMUST00000220247
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.4%
Validation Efficiency 100% (66/66)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reminiscent of Huntington disease (decreased body weight, impaired coordination, hyperactivity, increased rearing, decreased prepulse inhibition, increased stereotypic behavior, reduced striatum, and decreased brain weight). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik T C 4: 62,543,445 probably benign Het
Abcb10 C T 8: 123,971,001 G195S probably benign Het
Adrb2 A G 18: 62,179,553 V67A possibly damaging Het
Alx4 A T 2: 93,668,357 K145* probably null Het
Arl8a G A 1: 135,146,980 M1I probably null Het
B230118H07Rik T C 2: 101,610,519 probably benign Het
Btbd16 G A 7: 130,786,053 S134N probably benign Het
Ccdc136 T A 6: 29,414,934 L474Q probably damaging Het
Cebpz A G 17: 78,935,650 Y192H probably benign Het
Cep95 A G 11: 106,818,685 Q109R probably null Het
Cfap54 G T 10: 93,038,975 Q520K possibly damaging Het
Cog2 C T 8: 124,548,514 probably benign Het
Cul1 A G 6: 47,523,773 N702S probably benign Het
D430041D05Rik G C 2: 104,167,950 P1836R probably damaging Het
Dmxl2 T C 9: 54,383,750 D2472G probably damaging Het
Ect2 A G 3: 27,150,095 F22L probably benign Het
Ehd4 A T 2: 120,102,341 D201E probably damaging Het
Eif4ebp3 A G 18: 36,664,301 probably null Het
Exd2 T C 12: 80,490,770 probably benign Het
Gtf2a1 A C 12: 91,568,273 probably null Het
H2-DMb1 A G 17: 34,159,656 Y256C probably damaging Het
Haus6 T C 4: 86,585,807 R527G probably benign Het
Helb C T 10: 120,094,212 probably benign Het
Hhatl C T 9: 121,788,762 A254T probably benign Het
Hk1 A T 10: 62,299,275 probably benign Het
Hmcn2 A G 2: 31,405,612 K2611R probably damaging Het
Hrc A G 7: 45,336,133 H236R possibly damaging Het
Hunk T A 16: 90,464,154 Y178N probably damaging Het
Jakmip2 G A 18: 43,558,169 Q616* probably null Het
Kcnh4 C T 11: 100,746,932 G633E probably benign Het
Msantd4 C T 9: 4,385,180 R302C probably damaging Het
Nae1 T C 8: 104,523,236 probably benign Het
Nek4 C T 14: 30,970,472 L293F probably damaging Het
Odf2l C T 3: 145,126,116 T44I possibly damaging Het
Olfr601 A G 7: 103,358,741 V151A possibly damaging Het
Otog G A 7: 46,265,936 probably benign Het
Ppp1r21 C T 17: 88,565,689 T425I possibly damaging Het
Prrc2b A G 2: 32,230,660 E2204G probably damaging Het
Prrc2c A C 1: 162,705,314 probably benign Het
Prrxl1 T C 14: 32,608,083 F81S probably damaging Het
Ptgs2 T C 1: 150,104,277 probably benign Het
Slc12a8 T A 16: 33,551,085 V197E probably damaging Het
Syne3 A G 12: 104,946,924 W593R possibly damaging Het
Tmem63a A T 1: 180,972,733 T696S probably benign Het
Tnks2 A G 19: 36,849,358 D165G possibly damaging Het
Trim43a T C 9: 88,588,187 W349R probably damaging Het
Unc45b T C 11: 82,929,567 probably benign Het
Vmn1r4 T A 6: 56,956,962 N150K probably damaging Het
Wdfy4 C A 14: 33,083,812 probably benign Het
Wdr77 T A 3: 105,960,026 D63E probably damaging Het
Zan T C 5: 137,464,902 T672A unknown Het
Other mutations in Zdhhc17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01546:Zdhhc17 APN 10 110946193 missense probably damaging 1.00
IGL01812:Zdhhc17 APN 10 110948217 missense possibly damaging 0.93
IGL01948:Zdhhc17 APN 10 110946276 missense possibly damaging 0.56
IGL02002:Zdhhc17 APN 10 110967689 missense probably benign
IGL03263:Zdhhc17 APN 10 110961016 missense probably damaging 1.00
R0153:Zdhhc17 UTSW 10 110955094 nonsense probably null
R0375:Zdhhc17 UTSW 10 110982106 nonsense probably null
R1452:Zdhhc17 UTSW 10 110955075 missense probably benign 0.04
R1496:Zdhhc17 UTSW 10 110946210 missense probably damaging 0.99
R1528:Zdhhc17 UTSW 10 110948189 critical splice donor site probably null
R1856:Zdhhc17 UTSW 10 110947293 splice site probably null
R2119:Zdhhc17 UTSW 10 110982048 missense possibly damaging 0.92
R3747:Zdhhc17 UTSW 10 110944420 missense probably benign 0.24
R4900:Zdhhc17 UTSW 10 110985958 missense possibly damaging 0.95
R5647:Zdhhc17 UTSW 10 110973833 missense probably damaging 1.00
R5758:Zdhhc17 UTSW 10 110944395 makesense probably null
R6228:Zdhhc17 UTSW 10 110956355 missense probably benign 0.01
R6823:Zdhhc17 UTSW 10 110955111 missense possibly damaging 0.91
R7172:Zdhhc17 UTSW 10 111009948 missense possibly damaging 0.82
R7874:Zdhhc17 UTSW 10 110982117 missense possibly damaging 0.93
Z1088:Zdhhc17 UTSW 10 110945466 splice site probably null
Predicted Primers PCR Primer
(F):5'- GAATAAATCCCAGTCCCACTCTACCCTT -3'
(R):5'- CAATGAACCATTAAGCCAGTcacacaag -3'

Sequencing Primer
(F):5'- TACTTGGCAGCATAGTCAAGC -3'
(R):5'- gggagctgaggcaagagg -3'
Posted On2013-05-23