Incidental Mutation 'R5006:Zbtb38'
ID 390170
Institutional Source Beutler Lab
Gene Symbol Zbtb38
Ensembl Gene ENSMUSG00000040433
Gene Name zinc finger and BTB domain containing 38
Synonyms CIBZ, A930014K01Rik, Zenon homolog
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.590) question?
Stock # R5006 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 96682770-96752831 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 96685651 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Serine at position 1127 (G1127S)
Ref Sequence ENSEMBL: ENSMUSP00000121753 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093798] [ENSMUST00000126066] [ENSMUST00000128269] [ENSMUST00000140121] [ENSMUST00000152594]
AlphaFold Q3LR78
Predicted Effect probably damaging
Transcript: ENSMUST00000093798
AA Change: G1127S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091315
Gene: ENSMUSG00000040433
AA Change: G1127S

DomainStartEndE-ValueType
BTB 33 131 5.68e-20 SMART
low complexity region 140 151 N/A INTRINSIC
ZnF_C2H2 340 362 7.67e-2 SMART
ZnF_C2H2 369 396 7.29e0 SMART
low complexity region 435 446 N/A INTRINSIC
ZnF_C2H2 458 480 2.2e-2 SMART
ZnF_C2H2 486 508 1.05e1 SMART
ZnF_C2H2 514 537 8.09e-1 SMART
low complexity region 911 935 N/A INTRINSIC
low complexity region 994 1002 N/A INTRINSIC
ZnF_C2H2 1013 1035 3.63e-3 SMART
ZnF_C2H2 1041 1063 9.73e-4 SMART
ZnF_C2H2 1069 1091 1.45e-2 SMART
ZnF_C2H2 1097 1119 1.02e1 SMART
ZnF_C2H2 1128 1150 1.67e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126066
SMART Domains Protein: ENSMUSP00000114300
Gene: ENSMUSG00000040433

DomainStartEndE-ValueType
BTB 33 131 5.68e-20 SMART
low complexity region 140 151 N/A INTRINSIC
ZnF_C2H2 340 362 7.67e-2 SMART
ZnF_C2H2 369 396 7.29e0 SMART
low complexity region 435 446 N/A INTRINSIC
ZnF_C2H2 458 480 2.2e-2 SMART
ZnF_C2H2 486 508 1.05e1 SMART
ZnF_C2H2 514 537 8.09e-1 SMART
low complexity region 911 926 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128269
SMART Domains Protein: ENSMUSP00000121871
Gene: ENSMUSG00000040433

DomainStartEndE-ValueType
BTB 33 131 5.68e-20 SMART
low complexity region 140 151 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140121
SMART Domains Protein: ENSMUSP00000120040
Gene: ENSMUSG00000040433

DomainStartEndE-ValueType
BTB 33 131 5.68e-20 SMART
low complexity region 140 151 N/A INTRINSIC
ZnF_C2H2 340 362 7.67e-2 SMART
ZnF_C2H2 369 396 7.29e0 SMART
low complexity region 435 446 N/A INTRINSIC
ZnF_C2H2 458 480 2.2e-2 SMART
ZnF_C2H2 486 508 1.05e1 SMART
ZnF_C2H2 514 537 8.09e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000152594
AA Change: G1127S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121753
Gene: ENSMUSG00000040433
AA Change: G1127S

DomainStartEndE-ValueType
BTB 33 131 5.68e-20 SMART
low complexity region 140 151 N/A INTRINSIC
ZnF_C2H2 340 362 7.67e-2 SMART
ZnF_C2H2 369 396 7.29e0 SMART
low complexity region 435 446 N/A INTRINSIC
ZnF_C2H2 458 480 2.2e-2 SMART
ZnF_C2H2 486 508 1.05e1 SMART
ZnF_C2H2 514 537 8.09e-1 SMART
low complexity region 911 935 N/A INTRINSIC
low complexity region 994 1002 N/A INTRINSIC
ZnF_C2H2 1013 1035 3.63e-3 SMART
ZnF_C2H2 1041 1063 9.73e-4 SMART
ZnF_C2H2 1069 1091 1.45e-2 SMART
ZnF_C2H2 1097 1119 1.02e1 SMART
ZnF_C2H2 1128 1150 1.67e-2 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger transcriptional activator that binds methylated DNA. The encoded protein can form homodimers or heterodimers through the zinc finger domains. In mouse, inhibition of this protein has been associated with apoptosis in some cell types. [provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf2 C A 5: 24,576,537 E51* probably null Het
Bcl11a T A 11: 24,164,989 Y777* probably null Het
C2cd4c T A 10: 79,612,507 T269S probably benign Het
Fam96a G A 9: 66,136,352 probably null Het
Foxp1 A C 6: 99,162,858 V54G probably damaging Het
Gm11639 T A 11: 104,729,677 probably null Het
Il2ra T G 2: 11,674,346 L39R possibly damaging Het
Klk1b9 A T 7: 43,979,287 K72* probably null Het
Lmo7 A G 14: 101,926,237 probably benign Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Nebl T A 2: 17,388,771 probably null Het
Olfr711 C T 7: 106,971,601 V248I probably damaging Het
Olfr849 A G 9: 19,441,249 N112S probably benign Het
Olfr860 G T 9: 19,846,271 A116E probably benign Het
Ralgapa1 A T 12: 55,718,114 C918S probably benign Het
Rasd2 G T 8: 75,218,606 R21L probably damaging Het
Sema4a A G 3: 88,436,784 M720T probably benign Het
Susd3 A G 13: 49,238,705 probably benign Het
Vmn1r235 T C 17: 21,262,205 M264T probably benign Het
Wls A G 3: 159,911,791 I368V possibly damaging Het
Ypel4 A G 2: 84,736,838 D5G probably benign Het
Other mutations in Zbtb38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Zbtb38 APN 9 96687494 missense probably damaging 1.00
IGL01895:Zbtb38 APN 9 96688408 missense probably benign 0.00
IGL02513:Zbtb38 APN 9 96687073 missense probably damaging 1.00
IGL02649:Zbtb38 APN 9 96686619 missense probably damaging 0.96
IGL02938:Zbtb38 APN 9 96687174 missense probably benign 0.11
PIT4131001:Zbtb38 UTSW 9 96686316 missense probably damaging 1.00
R0048:Zbtb38 UTSW 9 96687676 missense probably damaging 1.00
R0152:Zbtb38 UTSW 9 96686280 missense probably damaging 1.00
R0158:Zbtb38 UTSW 9 96686940 missense possibly damaging 0.46
R0519:Zbtb38 UTSW 9 96685773 missense probably damaging 1.00
R0594:Zbtb38 UTSW 9 96685954 missense probably damaging 1.00
R1556:Zbtb38 UTSW 9 96686991 missense probably benign 0.26
R1698:Zbtb38 UTSW 9 96685462 missense probably benign
R1772:Zbtb38 UTSW 9 96688041 missense probably damaging 1.00
R1799:Zbtb38 UTSW 9 96688881 missense probably damaging 1.00
R1837:Zbtb38 UTSW 9 96686995 missense probably benign
R2446:Zbtb38 UTSW 9 96687646 missense probably damaging 1.00
R3153:Zbtb38 UTSW 9 96688249 missense probably benign 0.34
R3950:Zbtb38 UTSW 9 96687546 missense probably damaging 1.00
R4240:Zbtb38 UTSW 9 96686102 small deletion probably benign
R4630:Zbtb38 UTSW 9 96688851 missense probably damaging 1.00
R4666:Zbtb38 UTSW 9 96688383 missense probably damaging 1.00
R4732:Zbtb38 UTSW 9 96687684 missense probably damaging 1.00
R4733:Zbtb38 UTSW 9 96687684 missense probably damaging 1.00
R4824:Zbtb38 UTSW 9 96688201 missense probably benign 0.06
R5109:Zbtb38 UTSW 9 96687009 missense probably damaging 0.99
R5251:Zbtb38 UTSW 9 96687108 missense probably benign 0.43
R5396:Zbtb38 UTSW 9 96687643 missense probably damaging 1.00
R5659:Zbtb38 UTSW 9 96687420 missense probably damaging 1.00
R6249:Zbtb38 UTSW 9 96685992 missense probably damaging 0.99
R6294:Zbtb38 UTSW 9 96687229 missense probably benign 0.05
R6615:Zbtb38 UTSW 9 96686654 nonsense probably null
R6625:Zbtb38 UTSW 9 96687313 missense probably damaging 1.00
R6885:Zbtb38 UTSW 9 96686464 missense probably damaging 1.00
R7304:Zbtb38 UTSW 9 96687427 missense probably damaging 0.96
R7675:Zbtb38 UTSW 9 96685541 missense probably benign 0.00
R7823:Zbtb38 UTSW 9 96685976 nonsense probably null
R7900:Zbtb38 UTSW 9 96688936 missense probably damaging 1.00
R8077:Zbtb38 UTSW 9 96688100 missense probably benign
R8432:Zbtb38 UTSW 9 96686238 missense possibly damaging 0.68
R8802:Zbtb38 UTSW 9 96685570 missense probably benign 0.13
R8930:Zbtb38 UTSW 9 96686381 missense probably benign 0.04
R8932:Zbtb38 UTSW 9 96686381 missense probably benign 0.04
R9008:Zbtb38 UTSW 9 96687047 missense probably benign
R9347:Zbtb38 UTSW 9 96685596 missense probably damaging 0.99
R9520:Zbtb38 UTSW 9 96686051 missense probably damaging 0.99
R9568:Zbtb38 UTSW 9 96688891 missense probably damaging 1.00
R9680:Zbtb38 UTSW 9 96688344 missense probably benign 0.03
R9777:Zbtb38 UTSW 9 96688302 missense possibly damaging 0.49
R9777:Zbtb38 UTSW 9 96688303 missense probably damaging 0.96
R9790:Zbtb38 UTSW 9 96688647 missense probably damaging 1.00
R9791:Zbtb38 UTSW 9 96688647 missense probably damaging 1.00
X0066:Zbtb38 UTSW 9 96687612 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAAGGACGTTTTCAGCAAAGG -3'
(R):5'- GCGTGAAGGAGTTCATCTGTC -3'

Sequencing Primer
(F):5'- GCAAAGGCTTTTATGTCATCCTTTTG -3'
(R):5'- CATCTGTCAGTATTGTAACAAGGC -3'
Posted On 2016-06-06