Incidental Mutation 'R5006:C2cd4c'
ID 390171
Institutional Source Beutler Lab
Gene Symbol C2cd4c
Ensembl Gene ENSMUSG00000045912
Gene Name C2 calcium-dependent domain containing 4C
Synonyms 4932409I22Rik, LOC237397, Fam148c
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.432) question?
Stock # R5006 (G1)
Quality Score 117
Status Not validated
Chromosome 10
Chromosomal Location 79606854-79614025 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 79612507 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 269 (T269S)
Ref Sequence ENSEMBL: ENSMUSP00000136013 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059699] [ENSMUST00000178228]
AlphaFold Q5HZI2
Predicted Effect probably benign
Transcript: ENSMUST00000059699
AA Change: T269S

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000059433
Gene: ENSMUSG00000045912
AA Change: T269S

DomainStartEndE-ValueType
low complexity region 75 94 N/A INTRINSIC
low complexity region 174 193 N/A INTRINSIC
C2 319 419 1.19e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178228
AA Change: T269S

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000136013
Gene: ENSMUSG00000045912
AA Change: T269S

DomainStartEndE-ValueType
low complexity region 75 94 N/A INTRINSIC
low complexity region 174 193 N/A INTRINSIC
C2 319 419 1.19e-4 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight but normal glucose homeostasis and pancreas development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf2 C A 5: 24,576,537 E51* probably null Het
Bcl11a T A 11: 24,164,989 Y777* probably null Het
Fam96a G A 9: 66,136,352 probably null Het
Foxp1 A C 6: 99,162,858 V54G probably damaging Het
Gm11639 T A 11: 104,729,677 probably null Het
Il2ra T G 2: 11,674,346 L39R possibly damaging Het
Klk1b9 A T 7: 43,979,287 K72* probably null Het
Lmo7 A G 14: 101,926,237 probably benign Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Nebl T A 2: 17,388,771 probably null Het
Olfr711 C T 7: 106,971,601 V248I probably damaging Het
Olfr849 A G 9: 19,441,249 N112S probably benign Het
Olfr860 G T 9: 19,846,271 A116E probably benign Het
Ralgapa1 A T 12: 55,718,114 C918S probably benign Het
Rasd2 G T 8: 75,218,606 R21L probably damaging Het
Sema4a A G 3: 88,436,784 M720T probably benign Het
Susd3 A G 13: 49,238,705 probably benign Het
Vmn1r235 T C 17: 21,262,205 M264T probably benign Het
Wls A G 3: 159,911,791 I368V possibly damaging Het
Ypel4 A G 2: 84,736,838 D5G probably benign Het
Zbtb38 C T 9: 96,685,651 G1127S probably damaging Het
Other mutations in C2cd4c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02660:C2cd4c APN 10 79613302 missense probably benign
IGL02950:C2cd4c APN 10 79612831 missense probably damaging 1.00
R0400:C2cd4c UTSW 10 79613209 missense probably damaging 1.00
R0925:C2cd4c UTSW 10 79612750 missense probably benign
R1428:C2cd4c UTSW 10 79612230 missense probably damaging 0.97
R2017:C2cd4c UTSW 10 79612989 missense possibly damaging 0.69
R2111:C2cd4c UTSW 10 79612421 missense probably damaging 1.00
R4951:C2cd4c UTSW 10 79613005 missense possibly damaging 0.93
R4982:C2cd4c UTSW 10 79613241 missense probably benign 0.01
R5281:C2cd4c UTSW 10 79613044 missense probably benign 0.00
R5699:C2cd4c UTSW 10 79612551 missense probably benign 0.00
R5870:C2cd4c UTSW 10 79612209 missense possibly damaging 0.93
R8221:C2cd4c UTSW 10 79612648 missense probably damaging 1.00
R9753:C2cd4c UTSW 10 79612233 missense probably damaging 1.00
Z1176:C2cd4c UTSW 10 79612465 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- GAAGTCCTCGTTGAAGATGGG -3'
(R):5'- AAGTGACACAGGGTCCTCTG -3'

Sequencing Primer
(F):5'- ATCACAGGGCCGGTCATACAG -3'
(R):5'- ACAGGGTCCTCTGCTGAGTC -3'
Posted On 2016-06-06