Incidental Mutation 'R5006:Bcl11a'
ID 390172
Institutional Source Beutler Lab
Gene Symbol Bcl11a
Ensembl Gene ENSMUSG00000000861
Gene Name B cell CLL/lymphoma 11A (zinc finger protein)
Synonyms 2810047E18Rik, Evi9c, Evi9, Evi9b, Evi9a, COUP-TF interacting protein 1, D930021L15Rik, CTIP1, mouse myeloid leukemia gene
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R5006 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 24078056-24174123 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 24164989 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 777 (Y777*)
Ref Sequence ENSEMBL: ENSMUSP00000105140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000881] [ENSMUST00000109514] [ENSMUST00000109516] [ENSMUST00000118955]
AlphaFold Q9QYE3
Predicted Effect probably benign
Transcript: ENSMUST00000000881
SMART Domains Protein: ENSMUSP00000000881
Gene: ENSMUSG00000000861

DomainStartEndE-ValueType
Pfam:zf-C2H2_6 45 73 5.9e-9 PFAM
ZnF_C2H2 170 193 7.15e-2 SMART
low complexity region 258 274 N/A INTRINSIC
low complexity region 327 338 N/A INTRINSIC
low complexity region 352 373 N/A INTRINSIC
ZnF_C2H2 377 399 6.23e-2 SMART
ZnF_C2H2 405 427 1.69e-3 SMART
low complexity region 456 472 N/A INTRINSIC
coiled coil region 481 513 N/A INTRINSIC
low complexity region 614 634 N/A INTRINSIC
low complexity region 682 696 N/A INTRINSIC
low complexity region 708 731 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000109514
AA Change: Y777*
SMART Domains Protein: ENSMUSP00000105140
Gene: ENSMUSG00000000861
AA Change: Y777*

DomainStartEndE-ValueType
Blast:ZnF_C2H2 46 72 8e-10 BLAST
ZnF_C2H2 170 193 7.15e-2 SMART
low complexity region 258 274 N/A INTRINSIC
low complexity region 327 338 N/A INTRINSIC
low complexity region 352 373 N/A INTRINSIC
ZnF_C2H2 377 399 6.23e-2 SMART
ZnF_C2H2 405 427 1.69e-3 SMART
low complexity region 456 472 N/A INTRINSIC
coiled coil region 481 513 N/A INTRINSIC
low complexity region 614 634 N/A INTRINSIC
low complexity region 682 696 N/A INTRINSIC
low complexity region 708 731 N/A INTRINSIC
ZnF_C2H2 742 764 1.41e0 SMART
ZnF_C2H2 770 792 4.24e-4 SMART
ZnF_C2H2 800 823 3.07e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109516
SMART Domains Protein: ENSMUSP00000105142
Gene: ENSMUSG00000000861

DomainStartEndE-ValueType
Pfam:zf-C2H2_6 45 73 3.2e-8 PFAM
ZnF_C2H2 170 193 7.15e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118955
SMART Domains Protein: ENSMUSP00000112948
Gene: ENSMUSG00000000861

DomainStartEndE-ValueType
ZnF_C2H2 118 141 7.15e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127494
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131383
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146717
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a C2H2 type zinc-finger protein by its similarity to the mouse Bcl11a/Evi9 protein. The corresponding mouse gene is a common site of retroviral integration in myeloid leukemia, and may function as a leukemia disease gene, in part, through its interaction with BCL6. During hematopoietic cell differentiation, this gene is down-regulated. It is possibly involved in lymphoma pathogenesis since translocations associated with B-cell malignancies also deregulates its expression. Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in B cell deficiency, alteration of T cell types, and neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf2 C A 5: 24,576,537 E51* probably null Het
C2cd4c T A 10: 79,612,507 T269S probably benign Het
Fam96a G A 9: 66,136,352 probably null Het
Foxp1 A C 6: 99,162,858 V54G probably damaging Het
Gm11639 T A 11: 104,729,677 probably null Het
Il2ra T G 2: 11,674,346 L39R possibly damaging Het
Klk1b9 A T 7: 43,979,287 K72* probably null Het
Lmo7 A G 14: 101,926,237 probably benign Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Nebl T A 2: 17,388,771 probably null Het
Olfr711 C T 7: 106,971,601 V248I probably damaging Het
Olfr849 A G 9: 19,441,249 N112S probably benign Het
Olfr860 G T 9: 19,846,271 A116E probably benign Het
Ralgapa1 A T 12: 55,718,114 C918S probably benign Het
Rasd2 G T 8: 75,218,606 R21L probably damaging Het
Sema4a A G 3: 88,436,784 M720T probably benign Het
Susd3 A G 13: 49,238,705 probably benign Het
Vmn1r235 T C 17: 21,262,205 M264T probably benign Het
Wls A G 3: 159,911,791 I368V possibly damaging Het
Ypel4 A G 2: 84,736,838 D5G probably benign Het
Zbtb38 C T 9: 96,685,651 G1127S probably damaging Het
Other mutations in Bcl11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Bcl11a APN 11 24163346 missense probably benign 0.00
IGL03190:Bcl11a APN 11 24158333 missense probably benign 0.00
R0317:Bcl11a UTSW 11 24172697 critical splice acceptor site probably null
R1061:Bcl11a UTSW 11 24164069 nonsense probably null
R1124:Bcl11a UTSW 11 24163928 missense probably damaging 1.00
R1163:Bcl11a UTSW 11 24165143 missense probably benign 0.41
R1498:Bcl11a UTSW 11 24164005 missense probably damaging 1.00
R1599:Bcl11a UTSW 11 24163887 missense probably damaging 1.00
R1689:Bcl11a UTSW 11 24163167 missense probably damaging 1.00
R1689:Bcl11a UTSW 11 24164406 missense possibly damaging 0.66
R1754:Bcl11a UTSW 11 24164724 missense probably damaging 1.00
R2036:Bcl11a UTSW 11 24164087 missense possibly damaging 0.71
R2207:Bcl11a UTSW 11 24163343 missense probably damaging 1.00
R3700:Bcl11a UTSW 11 24163890 missense probably damaging 1.00
R3779:Bcl11a UTSW 11 24164568 missense probably damaging 1.00
R4557:Bcl11a UTSW 11 24164004 missense probably damaging 1.00
R4703:Bcl11a UTSW 11 24163725 missense possibly damaging 0.80
R5053:Bcl11a UTSW 11 24164068 missense probably benign 0.03
R5495:Bcl11a UTSW 11 24165042 missense possibly damaging 0.73
R5581:Bcl11a UTSW 11 24163932 missense probably damaging 1.00
R5680:Bcl11a UTSW 11 24164264 missense possibly damaging 0.52
R5790:Bcl11a UTSW 11 24163650 missense probably damaging 1.00
R6291:Bcl11a UTSW 11 24158321 missense probably damaging 0.96
R6723:Bcl11a UTSW 11 24163646 missense probably damaging 1.00
R7116:Bcl11a UTSW 11 24163839 missense probably damaging 1.00
R7274:Bcl11a UTSW 11 24163985 missense probably damaging 1.00
R7569:Bcl11a UTSW 11 24085458 nonsense probably null
R7843:Bcl11a UTSW 11 24164831 missense probably benign 0.26
R7923:Bcl11a UTSW 11 24163680 missense probably damaging 1.00
R7964:Bcl11a UTSW 11 24163353 missense probably benign 0.28
R8211:Bcl11a UTSW 11 24078394 missense probably damaging 0.99
R8242:Bcl11a UTSW 11 24163208 missense probably benign 0.14
R8338:Bcl11a UTSW 11 24164578 missense probably damaging 1.00
R8478:Bcl11a UTSW 11 24165086 missense probably damaging 1.00
R8896:Bcl11a UTSW 11 24163640 missense probably benign 0.00
R8911:Bcl11a UTSW 11 24164763 missense probably damaging 1.00
R9489:Bcl11a UTSW 11 24164582 missense probably benign 0.00
Z1176:Bcl11a UTSW 11 24165010 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGCCCCATATTAGTGGTCC -3'
(R):5'- GGTGACAAGCACTCATTCATATTC -3'

Sequencing Primer
(F):5'- ATATTAGTGGTCCGGGCCC -3'
(R):5'- TGATCACATGGGACTAGAAAAATCC -3'
Posted On 2016-06-06