Incidental Mutation 'R5006:Susd3'
ID 390176
Institutional Source Beutler Lab
Gene Symbol Susd3
Ensembl Gene ENSMUSG00000021384
Gene Name sushi domain containing 3
Synonyms 2810440J20Rik, 1700017I11Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock # R5006 (G1)
Quality Score 201
Status Not validated
Chromosome 13
Chromosomal Location 49230690-49248706 bp(-) (GRCm38)
Type of Mutation intron
DNA Base Change (assembly) A to G at 49238705 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021816] [ENSMUST00000058196] [ENSMUST00000119721] [ENSMUST00000135784]
AlphaFold Q9D176
Predicted Effect probably benign
Transcript: ENSMUST00000021816
SMART Domains Protein: ENSMUSP00000021816
Gene: ENSMUSG00000021384

DomainStartEndE-ValueType
CCP 20 79 2.11e-9 SMART
transmembrane domain 95 117 N/A INTRINSIC
low complexity region 154 179 N/A INTRINSIC
low complexity region 218 231 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000058196
SMART Domains Protein: ENSMUSP00000061423
Gene: ENSMUSG00000021384

DomainStartEndE-ValueType
CCP 32 91 2.11e-9 SMART
transmembrane domain 107 129 N/A INTRINSIC
low complexity region 166 191 N/A INTRINSIC
low complexity region 230 243 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000119721
AA Change: V170A
SMART Domains Protein: ENSMUSP00000113631
Gene: ENSMUSG00000021384
AA Change: V170A

DomainStartEndE-ValueType
CCP 32 91 2.11e-9 SMART
transmembrane domain 107 129 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131880
Predicted Effect probably benign
Transcript: ENSMUST00000135784
SMART Domains Protein: ENSMUSP00000115888
Gene: ENSMUSG00000021384

DomainStartEndE-ValueType
transmembrane domain 32 54 N/A INTRINSIC
low complexity region 91 116 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141408
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf2 C A 5: 24,576,537 E51* probably null Het
Bcl11a T A 11: 24,164,989 Y777* probably null Het
C2cd4c T A 10: 79,612,507 T269S probably benign Het
Fam96a G A 9: 66,136,352 probably null Het
Foxp1 A C 6: 99,162,858 V54G probably damaging Het
Gm11639 T A 11: 104,729,677 probably null Het
Il2ra T G 2: 11,674,346 L39R possibly damaging Het
Klk1b9 A T 7: 43,979,287 K72* probably null Het
Lmo7 A G 14: 101,926,237 probably benign Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Nebl T A 2: 17,388,771 probably null Het
Olfr711 C T 7: 106,971,601 V248I probably damaging Het
Olfr849 A G 9: 19,441,249 N112S probably benign Het
Olfr860 G T 9: 19,846,271 A116E probably benign Het
Ralgapa1 A T 12: 55,718,114 C918S probably benign Het
Rasd2 G T 8: 75,218,606 R21L probably damaging Het
Sema4a A G 3: 88,436,784 M720T probably benign Het
Vmn1r235 T C 17: 21,262,205 M264T probably benign Het
Wls A G 3: 159,911,791 I368V possibly damaging Het
Ypel4 A G 2: 84,736,838 D5G probably benign Het
Zbtb38 C T 9: 96,685,651 G1127S probably damaging Het
Other mutations in Susd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Susd3 APN 13 49231138 makesense probably null
IGL03336:Susd3 APN 13 49238782 missense probably benign 0.09
R2122:Susd3 UTSW 13 49231150 missense probably damaging 1.00
R2343:Susd3 UTSW 13 49238859 missense probably damaging 0.99
R2923:Susd3 UTSW 13 49248469 start codon destroyed probably null 0.95
R4591:Susd3 UTSW 13 49231260 missense possibly damaging 0.57
R4661:Susd3 UTSW 13 49231302 splice site probably null
R5841:Susd3 UTSW 13 49238726 intron probably benign
R6285:Susd3 UTSW 13 49237521 missense probably damaging 1.00
R6796:Susd3 UTSW 13 49237565 frame shift probably null
R7193:Susd3 UTSW 13 49231203 missense probably damaging 1.00
R7311:Susd3 UTSW 13 49248430 missense probably benign 0.00
R7572:Susd3 UTSW 13 49231162 missense probably benign 0.31
R7697:Susd3 UTSW 13 49237598 missense probably damaging 1.00
R8239:Susd3 UTSW 13 49231255 missense probably benign
R8479:Susd3 UTSW 13 49237476 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- AGTGTTCCCCGTATGTGGAC -3'
(R):5'- TGAGCTGTGCCATCATCCTG -3'

Sequencing Primer
(F):5'- TGTGAGCATAATCCCAGCACTGTC -3'
(R):5'- ATCATCCTGCTCATGTCCATGG -3'
Posted On 2016-06-06