Incidental Mutation 'R5007:Mroh2a'
ID390184
Institutional Source Beutler Lab
Gene Symbol Mroh2a
Ensembl Gene ENSMUSG00000079429
Gene Namemaestro heat-like repeat family member 2A
SynonymsHeatr7b1, ENSMUSG00000044873, OTTMUSG00000020804
MMRRC Submission 042598-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.951) question?
Stock #R5007 (G1)
Quality Score156
Status Validated
Chromosome1
Chromosomal Location88226986-88262289 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) GCCC to GC at 88232257 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000108755 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061013] [ENSMUST00000113130]
Predicted Effect probably null
Transcript: ENSMUST00000061013
SMART Domains Protein: ENSMUSP00000130508
Gene: ENSMUSG00000079429

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
low complexity region 99 112 N/A INTRINSIC
low complexity region 1235 1248 N/A INTRINSIC
SCOP:d1jdha_ 1371 1669 9e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000113130
SMART Domains Protein: ENSMUSP00000108755
Gene: ENSMUSG00000079429

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
low complexity region 99 112 N/A INTRINSIC
low complexity region 1232 1245 N/A INTRINSIC
SCOP:d1gw5a_ 1446 1671 6e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148474
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 89.6%
Validation Efficiency 99% (89/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a HEAT-domain-containing protein. The function of the encoded protein has not been characterized. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik C G 7: 27,578,767 T242R probably damaging Het
Abca8b T C 11: 109,936,764 T1473A probably damaging Het
Adam22 T C 5: 8,167,393 Y134C probably damaging Het
Alg9 T A 9: 50,788,224 M183K probably damaging Het
Ambra1 T C 2: 91,772,310 I213T possibly damaging Het
Ankrd55 T A 13: 112,367,932 V376D probably benign Het
Ano4 A C 10: 89,112,945 V166G probably benign Het
Aox3 T A 1: 58,163,424 C730S probably benign Het
Apc T A 18: 34,312,963 Y953N probably damaging Het
Ass1 T C 2: 31,501,532 F273S possibly damaging Het
Atg2b T C 12: 105,643,876 probably null Het
B3gnt9 A G 8: 105,254,490 Y89H probably damaging Het
Cd38 T G 5: 43,906,164 F200V probably damaging Het
Cep170 G T 1: 176,769,814 R388S probably benign Het
Col22a1 A T 15: 71,944,422 D614E probably damaging Het
Crybg3 C A 16: 59,558,100 probably benign Het
Ctdp1 A T 18: 80,420,480 S114T probably damaging Het
Dctd C T 8: 48,137,414 probably benign Het
Dmtf1 T C 5: 9,122,439 probably benign Het
Dnhd1 G A 7: 105,713,076 V3715M probably damaging Het
Dok1 A T 6: 83,032,316 L185H probably damaging Het
Dpep1 T C 8: 123,199,378 V152A probably damaging Het
Eif2ak1 G T 5: 143,873,880 R136L probably benign Het
Eml5 A T 12: 98,830,965 S1063T probably damaging Het
Fam171b T A 2: 83,855,509 L179* probably null Het
Fam213b A G 4: 154,897,074 probably null Het
Flot1 G T 17: 35,824,375 probably benign Het
Fmn2 A T 1: 174,744,300 H1491L probably damaging Het
Frem1 C T 4: 82,940,812 probably benign Het
Gdf2 A G 14: 33,944,906 D195G probably benign Het
Golga4 T G 9: 118,558,300 C1497G probably benign Het
Gpaa1 T A 15: 76,331,668 C33* probably null Het
Hectd1 A T 12: 51,802,660 C254S possibly damaging Het
Hspa1b C T 17: 34,958,110 A300T probably benign Het
Igf2bp2 A G 16: 22,079,496 I233T probably damaging Het
Iqce C A 5: 140,675,248 A491S possibly damaging Het
Irak3 A G 10: 120,146,429 probably null Het
Kcnip1 T A 11: 33,642,495 H124L probably benign Het
Klhdc10 G A 6: 30,450,641 R393Q probably benign Het
Klhl28 C T 12: 64,957,227 E171K probably damaging Het
Map2 T C 1: 66,413,289 V288A possibly damaging Het
Mdp1 C T 14: 55,659,226 R126Q probably damaging Het
Meltf A G 16: 31,887,562 D288G possibly damaging Het
Mgat4e T A 1: 134,541,152 I385F probably benign Het
Mical3 A C 6: 121,038,069 V211G probably damaging Het
Mlh1 A G 9: 111,271,410 *39R probably null Het
Mre11a A G 9: 14,809,820 D345G probably benign Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Nat1 T G 8: 67,491,425 L154R probably benign Het
Nlrp4a A G 7: 26,462,480 D851G probably damaging Het
Npas4 A C 19: 4,989,656 V54G possibly damaging Het
Olfr702 T C 7: 106,824,157 Y123C probably damaging Het
Pcbp4 G A 9: 106,462,093 G100R probably damaging Het
Pcdh17 A G 14: 84,533,297 T1072A probably benign Het
Pcdh18 T C 3: 49,754,457 N803S probably benign Het
Ppat C T 5: 76,928,678 probably benign Het
Ppm1l T A 3: 69,317,598 L11Q probably damaging Het
Pram1 T A 17: 33,645,437 V658E probably damaging Het
Prr12 C T 7: 45,049,801 probably benign Het
Ptprq A G 10: 107,608,276 V1489A probably benign Het
Ryr1 T A 7: 29,069,115 I2817F probably damaging Het
Sall2 A G 14: 52,314,493 L413P probably damaging Het
Slc7a9 T A 7: 35,454,129 M185K probably benign Het
Stag2 C T X: 42,266,253 H1149Y possibly damaging Het
Timm10b T A 7: 105,641,091 Y64N probably damaging Het
Tmem30c T C 16: 57,266,505 T312A probably benign Het
Tmem9b G T 7: 109,745,343 C17* probably null Het
Vmn2r68 C A 7: 85,232,414 R486L probably benign Het
Xkr9 T A 1: 13,701,163 I301N probably damaging Het
Xpo7 T C 14: 70,688,264 Q446R probably damaging Het
Ythdf3 T C 3: 16,205,198 V503A possibly damaging Het
Zfp280b T A 10: 76,039,214 V309D probably damaging Het
Zfp53 T A 17: 21,509,510 C602S probably benign Het
Zfp616 A T 11: 74,083,817 N395I possibly damaging Het
Zfp644 T C 5: 106,636,001 I862M probably benign Het
Zfp715 T C 7: 43,299,595 T314A possibly damaging Het
Other mutations in Mroh2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Mroh2a APN 1 88230746 missense probably damaging 0.99
IGL00990:Mroh2a APN 1 88244970 missense probably benign 0.03
IGL00990:Mroh2a APN 1 88234120 missense possibly damaging 0.76
IGL03097:Mroh2a UTSW 1 88235376 missense probably benign 0.30
R0032:Mroh2a UTSW 1 88256166 frame shift probably null
R0068:Mroh2a UTSW 1 88256166 frame shift probably null
R0139:Mroh2a UTSW 1 88257802 missense probably damaging 1.00
R0197:Mroh2a UTSW 1 88246042 missense probably damaging 1.00
R0242:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R0322:Mroh2a UTSW 1 88230680 nonsense probably null
R0374:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R0387:Mroh2a UTSW 1 88246042 missense probably damaging 1.00
R0412:Mroh2a UTSW 1 88235216 missense probably benign 0.01
R0536:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R0548:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R0580:Mroh2a UTSW 1 88243950 missense probably damaging 1.00
R0581:Mroh2a UTSW 1 88256166 frame shift probably null
R0583:Mroh2a UTSW 1 88256166 frame shift probably null
R0613:Mroh2a UTSW 1 88243950 missense probably damaging 1.00
R0652:Mroh2a UTSW 1 88230680 nonsense probably null
R0657:Mroh2a UTSW 1 88255565 missense probably damaging 1.00
R0659:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R0659:Mroh2a UTSW 1 88250342 missense probably damaging 1.00
R0671:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R0675:Mroh2a UTSW 1 88228380 missense probably damaging 0.99
R0675:Mroh2a UTSW 1 88250342 missense probably damaging 1.00
R0689:Mroh2a UTSW 1 88230680 nonsense probably null
R0689:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R0735:Mroh2a UTSW 1 88243950 missense probably damaging 1.00
R0761:Mroh2a UTSW 1 88243950 missense probably damaging 1.00
R0766:Mroh2a UTSW 1 88230680 nonsense probably null
R0845:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R0853:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R0959:Mroh2a UTSW 1 88232257 frame shift probably null
R0960:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R1004:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R1013:Mroh2a UTSW 1 88234612 critical splice donor site probably null
R1028:Mroh2a UTSW 1 88235376 missense probably benign 0.30
R1268:Mroh2a UTSW 1 88230680 nonsense probably null
R1281:Mroh2a UTSW 1 88256167 frame shift probably null
R1414:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R1439:Mroh2a UTSW 1 88257802 missense probably damaging 1.00
R1441:Mroh2a UTSW 1 88241631 missense possibly damaging 0.93
R1442:Mroh2a UTSW 1 88232353 splice site probably benign
R1442:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R1465:Mroh2a UTSW 1 88257802 missense probably damaging 1.00
R1662:Mroh2a UTSW 1 88241618 missense probably benign 0.07
R1686:Mroh2a UTSW 1 88230680 nonsense probably null
R1686:Mroh2a UTSW 1 88234612 critical splice donor site probably null
R1780:Mroh2a UTSW 1 88230680 nonsense probably null
R1846:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R1899:Mroh2a UTSW 1 88235376 missense probably benign 0.30
R1958:Mroh2a UTSW 1 88237491 nonsense probably null
R2122:Mroh2a UTSW 1 88256754 missense probably benign 0.37
R2248:Mroh2a UTSW 1 88256754 missense probably benign 0.37
R2306:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R2869:Mroh2a UTSW 1 88232257 frame shift probably null
R2870:Mroh2a UTSW 1 88232257 frame shift probably null
R2871:Mroh2a UTSW 1 88255565 missense probably damaging 1.00
R2872:Mroh2a UTSW 1 88232257 frame shift probably null
R3408:Mroh2a UTSW 1 88232257 frame shift probably null
R3608:Mroh2a UTSW 1 88244995 missense probably damaging 1.00
R3730:Mroh2a UTSW 1 88232257 frame shift probably null
R3937:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R4022:Mroh2a UTSW 1 88246042 missense probably damaging 1.00
R4049:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R4133:Mroh2a UTSW 1 88254965 missense possibly damaging 0.95
R4361:Mroh2a UTSW 1 88254965 missense possibly damaging 0.95
R4392:Mroh2a UTSW 1 88259589 missense probably damaging 1.00
R4401:Mroh2a UTSW 1 88254935 missense possibly damaging 0.72
R4402:Mroh2a UTSW 1 88254935 missense possibly damaging 0.72
R4575:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R4625:Mroh2a UTSW 1 88254965 missense possibly damaging 0.95
R4631:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R4665:Mroh2a UTSW 1 88241618 missense probably benign 0.07
R4701:Mroh2a UTSW 1 88234612 critical splice donor site probably null
R4701:Mroh2a UTSW 1 88241618 missense probably benign 0.07
R4771:Mroh2a UTSW 1 88251365 missense probably damaging 1.00
R4795:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R4839:Mroh2a UTSW 1 88237944 missense probably damaging 1.00
R4873:Mroh2a UTSW 1 88254935 missense possibly damaging 0.72
R4875:Mroh2a UTSW 1 88254935 missense possibly damaging 0.72
R4896:Mroh2a UTSW 1 88256754 missense probably benign 0.37
R5031:Mroh2a UTSW 1 88232257 frame shift probably null
R5062:Mroh2a UTSW 1 88232257 frame shift probably null
R5301:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R5367:Mroh2a UTSW 1 88254965 missense possibly damaging 0.95
R5371:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R5446:Mroh2a UTSW 1 88254965 missense possibly damaging 0.95
R5484:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R5506:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R5561:Mroh2a UTSW 1 88232257 frame shift probably null
R5615:Mroh2a UTSW 1 88232257 frame shift probably null
R5825:Mroh2a UTSW 1 88230680 nonsense probably null
R5891:Mroh2a UTSW 1 88241615 missense possibly damaging 0.93
R5906:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R5928:Mroh2a UTSW 1 88241618 missense probably benign 0.07
R6004:Mroh2a UTSW 1 88248655 missense probably damaging 1.00
R6035:Mroh2a UTSW 1 88230668 missense probably damaging 1.00
R6064:Mroh2a UTSW 1 88232257 frame shift probably null
R6074:Mroh2a UTSW 1 88258664 missense probably benign 0.00
R6091:Mroh2a UTSW 1 88232257 frame shift probably null
R6127:Mroh2a UTSW 1 88234612 critical splice donor site probably null
R6234:Mroh2a UTSW 1 88234612 critical splice donor site probably null
R6234:Mroh2a UTSW 1 88256754 missense probably benign 0.37
R6244:Mroh2a UTSW 1 88256754 missense probably benign 0.37
R6464:Mroh2a UTSW 1 88257802 missense probably damaging 1.00
R6465:Mroh2a UTSW 1 88232257 frame shift probably null
R6575:Mroh2a UTSW 1 88232257 frame shift probably null
R6809:Mroh2a UTSW 1 88235216 missense probably benign 0.01
R6819:Mroh2a UTSW 1 88242420 missense possibly damaging 0.77
R6854:Mroh2a UTSW 1 88243950 missense probably damaging 1.00
R6860:Mroh2a UTSW 1 88254935 missense possibly damaging 0.72
R7126:Mroh2a UTSW 1 88254935 missense possibly damaging 0.72
V5622:Mroh2a UTSW 1 88227091 start gained probably benign
V8831:Mroh2a UTSW 1 88256167 frame shift probably null
X0027:Mroh2a UTSW 1 88248613 missense possibly damaging 0.86
X0028:Mroh2a UTSW 1 88232257 frame shift probably null
X0028:Mroh2a UTSW 1 88256166 frame shift probably null
X0033:Mroh2a UTSW 1 88256166 frame shift probably null
X0034:Mroh2a UTSW 1 88232257 frame shift probably null
X0034:Mroh2a UTSW 1 88232292 missense probably damaging 1.00
X0034:Mroh2a UTSW 1 88256166 frame shift probably null
X0039:Mroh2a UTSW 1 88232257 frame shift probably null
X0057:Mroh2a UTSW 1 88232257 frame shift probably null
X0057:Mroh2a UTSW 1 88255655 missense probably benign 0.25
X0057:Mroh2a UTSW 1 88256166 frame shift probably null
X0063:Mroh2a UTSW 1 88232257 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CATATGCCCTTGAGCAGACATG -3'
(R):5'- GCAAAGCAACCACTGGGATG -3'

Sequencing Primer
(F):5'- AGTTCACCCTTTTTAAACATGTGGC -3'
(R):5'- TGGGATGCAAACCAACTTCTCATTC -3'
Posted On2016-06-06