Incidental Mutation 'R5007:Ythdf3'
ID390192
Institutional Source Beutler Lab
Gene Symbol Ythdf3
Ensembl Gene ENSMUSG00000047213
Gene NameYTH domain family 3
Synonyms9130022A11Rik
MMRRC Submission 042598-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.396) question?
Stock #R5007 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location16183212-16217037 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 16205198 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 503 (V503A)
Ref Sequence ENSEMBL: ENSMUSP00000103982 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108345] [ENSMUST00000108346] [ENSMUST00000191774]
Predicted Effect possibly damaging
Transcript: ENSMUST00000108345
AA Change: V503A

PolyPhen 2 Score 0.511 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103982
Gene: ENSMUSG00000047213
AA Change: V503A

DomainStartEndE-ValueType
low complexity region 48 64 N/A INTRINSIC
low complexity region 134 161 N/A INTRINSIC
low complexity region 244 255 N/A INTRINSIC
low complexity region 289 351 N/A INTRINSIC
low complexity region 379 394 N/A INTRINSIC
Pfam:YTH 415 553 1.5e-50 PFAM
low complexity region 567 582 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108346
AA Change: V514A

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103983
Gene: ENSMUSG00000047213
AA Change: V514A

DomainStartEndE-ValueType
low complexity region 59 75 N/A INTRINSIC
low complexity region 145 172 N/A INTRINSIC
low complexity region 255 266 N/A INTRINSIC
low complexity region 300 362 N/A INTRINSIC
low complexity region 390 405 N/A INTRINSIC
Pfam:YTH 427 562 1.1e-44 PFAM
low complexity region 578 593 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000191774
AA Change: V507A

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000141610
Gene: ENSMUSG00000047213
AA Change: V507A

DomainStartEndE-ValueType
low complexity region 52 68 N/A INTRINSIC
low complexity region 138 165 N/A INTRINSIC
low complexity region 248 259 N/A INTRINSIC
low complexity region 293 355 N/A INTRINSIC
low complexity region 383 398 N/A INTRINSIC
Pfam:YTH 419 557 1.6e-50 PFAM
low complexity region 571 586 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193598
Meta Mutation Damage Score 0.1341 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 89.6%
Validation Efficiency 99% (89/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the YTH (YT521-B homology) domain protein family. The YTH domain is common in eukaryotes, is often found in the middle of the protein sequence, and may function in binding to RNA. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2013]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik C G 7: 27,578,767 T242R probably damaging Het
Abca8b T C 11: 109,936,764 T1473A probably damaging Het
Adam22 T C 5: 8,167,393 Y134C probably damaging Het
Alg9 T A 9: 50,788,224 M183K probably damaging Het
Ambra1 T C 2: 91,772,310 I213T possibly damaging Het
Ankrd55 T A 13: 112,367,932 V376D probably benign Het
Ano4 A C 10: 89,112,945 V166G probably benign Het
Aox3 T A 1: 58,163,424 C730S probably benign Het
Apc T A 18: 34,312,963 Y953N probably damaging Het
Ass1 T C 2: 31,501,532 F273S possibly damaging Het
Atg2b T C 12: 105,643,876 probably null Het
B3gnt9 A G 8: 105,254,490 Y89H probably damaging Het
Cd38 T G 5: 43,906,164 F200V probably damaging Het
Cep170 G T 1: 176,769,814 R388S probably benign Het
Col22a1 A T 15: 71,944,422 D614E probably damaging Het
Crybg3 C A 16: 59,558,100 probably benign Het
Ctdp1 A T 18: 80,420,480 S114T probably damaging Het
Dctd C T 8: 48,137,414 probably benign Het
Dmtf1 T C 5: 9,122,439 probably benign Het
Dnhd1 G A 7: 105,713,076 V3715M probably damaging Het
Dok1 A T 6: 83,032,316 L185H probably damaging Het
Dpep1 T C 8: 123,199,378 V152A probably damaging Het
Eif2ak1 G T 5: 143,873,880 R136L probably benign Het
Eml5 A T 12: 98,830,965 S1063T probably damaging Het
Fam171b T A 2: 83,855,509 L179* probably null Het
Fam213b A G 4: 154,897,074 probably null Het
Flot1 G T 17: 35,824,375 probably benign Het
Fmn2 A T 1: 174,744,300 H1491L probably damaging Het
Frem1 C T 4: 82,940,812 probably benign Het
Gdf2 A G 14: 33,944,906 D195G probably benign Het
Golga4 T G 9: 118,558,300 C1497G probably benign Het
Gpaa1 T A 15: 76,331,668 C33* probably null Het
Hectd1 A T 12: 51,802,660 C254S possibly damaging Het
Hspa1b C T 17: 34,958,110 A300T probably benign Het
Igf2bp2 A G 16: 22,079,496 I233T probably damaging Het
Iqce C A 5: 140,675,248 A491S possibly damaging Het
Irak3 A G 10: 120,146,429 probably null Het
Kcnip1 T A 11: 33,642,495 H124L probably benign Het
Klhdc10 G A 6: 30,450,641 R393Q probably benign Het
Klhl28 C T 12: 64,957,227 E171K probably damaging Het
Map2 T C 1: 66,413,289 V288A possibly damaging Het
Mdp1 C T 14: 55,659,226 R126Q probably damaging Het
Meltf A G 16: 31,887,562 D288G possibly damaging Het
Mgat4e T A 1: 134,541,152 I385F probably benign Het
Mical3 A C 6: 121,038,069 V211G probably damaging Het
Mlh1 A G 9: 111,271,410 *39R probably null Het
Mre11a A G 9: 14,809,820 D345G probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Nat1 T G 8: 67,491,425 L154R probably benign Het
Nlrp4a A G 7: 26,462,480 D851G probably damaging Het
Npas4 A C 19: 4,989,656 V54G possibly damaging Het
Olfr702 T C 7: 106,824,157 Y123C probably damaging Het
Pcbp4 G A 9: 106,462,093 G100R probably damaging Het
Pcdh17 A G 14: 84,533,297 T1072A probably benign Het
Pcdh18 T C 3: 49,754,457 N803S probably benign Het
Ppat C T 5: 76,928,678 probably benign Het
Ppm1l T A 3: 69,317,598 L11Q probably damaging Het
Pram1 T A 17: 33,645,437 V658E probably damaging Het
Prr12 C T 7: 45,049,801 probably benign Het
Ptprq A G 10: 107,608,276 V1489A probably benign Het
Ryr1 T A 7: 29,069,115 I2817F probably damaging Het
Sall2 A G 14: 52,314,493 L413P probably damaging Het
Slc7a9 T A 7: 35,454,129 M185K probably benign Het
Stag2 C T X: 42,266,253 H1149Y possibly damaging Het
Timm10b T A 7: 105,641,091 Y64N probably damaging Het
Tmem30c T C 16: 57,266,505 T312A probably benign Het
Tmem9b G T 7: 109,745,343 C17* probably null Het
Vmn2r68 C A 7: 85,232,414 R486L probably benign Het
Xkr9 T A 1: 13,701,163 I301N probably damaging Het
Xpo7 T C 14: 70,688,264 Q446R probably damaging Het
Zfp280b T A 10: 76,039,214 V309D probably damaging Het
Zfp53 T A 17: 21,509,510 C602S probably benign Het
Zfp616 A T 11: 74,083,817 N395I possibly damaging Het
Zfp644 T C 5: 106,636,001 I862M probably benign Het
Zfp715 T C 7: 43,299,595 T314A possibly damaging Het
Other mutations in Ythdf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02585:Ythdf3 APN 3 16189478 missense probably benign 0.01
IGL03068:Ythdf3 APN 3 16204718 missense possibly damaging 0.92
Disinclined UTSW 3 16203192 nonsense probably null
R0501:Ythdf3 UTSW 3 16205072 missense probably damaging 0.98
R0644:Ythdf3 UTSW 3 16204892 missense possibly damaging 0.46
R1667:Ythdf3 UTSW 3 16204892 missense possibly damaging 0.46
R1940:Ythdf3 UTSW 3 16205092 missense possibly damaging 0.71
R2121:Ythdf3 UTSW 3 16205192 missense possibly damaging 0.71
R2191:Ythdf3 UTSW 3 16203211 intron probably benign
R2341:Ythdf3 UTSW 3 16203215 intron probably benign
R2512:Ythdf3 UTSW 3 16204895 missense possibly damaging 0.66
R2850:Ythdf3 UTSW 3 16203818 splice site probably benign
R3037:Ythdf3 UTSW 3 16205191 missense probably benign 0.32
R4934:Ythdf3 UTSW 3 16204056 missense probably damaging 0.97
R5164:Ythdf3 UTSW 3 16183513 missense possibly damaging 0.67
R5172:Ythdf3 UTSW 3 16204034 missense probably damaging 1.00
R5480:Ythdf3 UTSW 3 16183500 missense possibly damaging 0.83
R5512:Ythdf3 UTSW 3 16183922 missense probably damaging 0.98
R6059:Ythdf3 UTSW 3 16203192 nonsense probably null
R6104:Ythdf3 UTSW 3 16205161 missense possibly damaging 0.51
R6273:Ythdf3 UTSW 3 16204856 missense possibly damaging 0.92
R6721:Ythdf3 UTSW 3 16203861 missense possibly damaging 0.72
R7187:Ythdf3 UTSW 3 16204287 missense probably benign 0.05
R7285:Ythdf3 UTSW 3 16203885 synonymous probably null
R7307:Ythdf3 UTSW 3 16183500 missense possibly damaging 0.83
R7816:Ythdf3 UTSW 3 16189517 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GCGTTTGGATGCAGCTTATC -3'
(R):5'- TCCACCTATAAGGAAGGATTCTCAC -3'

Sequencing Primer
(F):5'- GATGCAGCTTATCGTTCCCTGAATG -3'
(R):5'- GACGCTTTTCATAATGTGCAAAGTC -3'
Posted On2016-06-06