Incidental Mutation 'R5007:Zfp715'
ID390209
Institutional Source Beutler Lab
Gene Symbol Zfp715
Ensembl Gene ENSMUSG00000012640
Gene Namezinc finger protein 715
Synonymsmszf15, 2610041B18Rik
MMRRC Submission 042598-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R5007 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location43296197-43313294 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43299595 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 314 (T314A)
Ref Sequence ENSEMBL: ENSMUSP00000103620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012796] [ENSMUST00000048015] [ENSMUST00000107986] [ENSMUST00000135130] [ENSMUST00000139061] [ENSMUST00000145622]
Predicted Effect probably benign
Transcript: ENSMUST00000012796
SMART Domains Protein: ENSMUSP00000012796
Gene: ENSMUSG00000012640

DomainStartEndE-ValueType
KRAB 48 108 3.87e-30 SMART
ZnF_C2H2 124 146 3.39e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000048015
AA Change: T314A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000040282
Gene: ENSMUSG00000012640
AA Change: T314A

DomainStartEndE-ValueType
KRAB 48 108 3.87e-30 SMART
ZnF_C2H2 356 378 1.28e-3 SMART
ZnF_C2H2 384 406 1.03e-2 SMART
ZnF_C2H2 412 434 4.79e-3 SMART
ZnF_C2H2 440 462 1.45e-2 SMART
ZnF_C2H2 468 490 1.12e-3 SMART
ZnF_C2H2 496 518 2.57e-3 SMART
ZnF_C2H2 524 546 4.79e-3 SMART
ZnF_C2H2 552 574 1.92e-2 SMART
ZnF_C2H2 580 602 9.58e-3 SMART
ZnF_C2H2 608 630 8.6e-5 SMART
ZnF_C2H2 636 658 1.13e-4 SMART
ZnF_C2H2 691 713 1.98e-4 SMART
ZnF_C2H2 719 741 8.34e-3 SMART
ZnF_C2H2 747 769 3.95e-4 SMART
ZnF_C2H2 775 797 4.94e-5 SMART
ZnF_C2H2 803 825 3.39e-3 SMART
ZnF_C2H2 831 853 1.95e-3 SMART
ZnF_C2H2 859 881 2.09e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107986
AA Change: T314A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103620
Gene: ENSMUSG00000012640
AA Change: T314A

DomainStartEndE-ValueType
KRAB 48 108 3.87e-30 SMART
ZnF_C2H2 356 378 1.28e-3 SMART
ZnF_C2H2 384 406 1.03e-2 SMART
ZnF_C2H2 412 434 4.79e-3 SMART
ZnF_C2H2 440 462 1.45e-2 SMART
ZnF_C2H2 468 490 1.12e-3 SMART
ZnF_C2H2 496 518 2.57e-3 SMART
ZnF_C2H2 524 546 4.79e-3 SMART
ZnF_C2H2 552 574 1.92e-2 SMART
ZnF_C2H2 580 602 9.58e-3 SMART
ZnF_C2H2 608 630 8.6e-5 SMART
ZnF_C2H2 636 658 1.13e-4 SMART
ZnF_C2H2 691 713 1.98e-4 SMART
ZnF_C2H2 719 741 8.34e-3 SMART
ZnF_C2H2 747 769 3.95e-4 SMART
ZnF_C2H2 775 797 4.94e-5 SMART
ZnF_C2H2 803 825 3.39e-3 SMART
ZnF_C2H2 831 853 1.95e-3 SMART
ZnF_C2H2 859 881 2.09e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135130
SMART Domains Protein: ENSMUSP00000122812
Gene: ENSMUSG00000012640

DomainStartEndE-ValueType
KRAB 48 88 5.49e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139061
SMART Domains Protein: ENSMUSP00000114600
Gene: ENSMUSG00000012640

DomainStartEndE-ValueType
KRAB 48 108 3.87e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145622
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151659
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 89.6%
Validation Efficiency 99% (89/90)
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik C G 7: 27,578,767 T242R probably damaging Het
Abca8b T C 11: 109,936,764 T1473A probably damaging Het
Adam22 T C 5: 8,167,393 Y134C probably damaging Het
Alg9 T A 9: 50,788,224 M183K probably damaging Het
Ambra1 T C 2: 91,772,310 I213T possibly damaging Het
Ankrd55 T A 13: 112,367,932 V376D probably benign Het
Ano4 A C 10: 89,112,945 V166G probably benign Het
Aox3 T A 1: 58,163,424 C730S probably benign Het
Apc T A 18: 34,312,963 Y953N probably damaging Het
Ass1 T C 2: 31,501,532 F273S possibly damaging Het
Atg2b T C 12: 105,643,876 probably null Het
B3gnt9 A G 8: 105,254,490 Y89H probably damaging Het
Cd38 T G 5: 43,906,164 F200V probably damaging Het
Cep170 G T 1: 176,769,814 R388S probably benign Het
Col22a1 A T 15: 71,944,422 D614E probably damaging Het
Crybg3 C A 16: 59,558,100 probably benign Het
Ctdp1 A T 18: 80,420,480 S114T probably damaging Het
Dctd C T 8: 48,137,414 probably benign Het
Dmtf1 T C 5: 9,122,439 probably benign Het
Dnhd1 G A 7: 105,713,076 V3715M probably damaging Het
Dok1 A T 6: 83,032,316 L185H probably damaging Het
Dpep1 T C 8: 123,199,378 V152A probably damaging Het
Eif2ak1 G T 5: 143,873,880 R136L probably benign Het
Eml5 A T 12: 98,830,965 S1063T probably damaging Het
Fam171b T A 2: 83,855,509 L179* probably null Het
Fam213b A G 4: 154,897,074 probably null Het
Flot1 G T 17: 35,824,375 probably benign Het
Fmn2 A T 1: 174,744,300 H1491L probably damaging Het
Frem1 C T 4: 82,940,812 probably benign Het
Gdf2 A G 14: 33,944,906 D195G probably benign Het
Golga4 T G 9: 118,558,300 C1497G probably benign Het
Gpaa1 T A 15: 76,331,668 C33* probably null Het
Hectd1 A T 12: 51,802,660 C254S possibly damaging Het
Hspa1b C T 17: 34,958,110 A300T probably benign Het
Igf2bp2 A G 16: 22,079,496 I233T probably damaging Het
Iqce C A 5: 140,675,248 A491S possibly damaging Het
Irak3 A G 10: 120,146,429 probably null Het
Kcnip1 T A 11: 33,642,495 H124L probably benign Het
Klhdc10 G A 6: 30,450,641 R393Q probably benign Het
Klhl28 C T 12: 64,957,227 E171K probably damaging Het
Map2 T C 1: 66,413,289 V288A possibly damaging Het
Mdp1 C T 14: 55,659,226 R126Q probably damaging Het
Meltf A G 16: 31,887,562 D288G possibly damaging Het
Mgat4e T A 1: 134,541,152 I385F probably benign Het
Mical3 A C 6: 121,038,069 V211G probably damaging Het
Mlh1 A G 9: 111,271,410 *39R probably null Het
Mre11a A G 9: 14,809,820 D345G probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Nat1 T G 8: 67,491,425 L154R probably benign Het
Nlrp4a A G 7: 26,462,480 D851G probably damaging Het
Npas4 A C 19: 4,989,656 V54G possibly damaging Het
Olfr702 T C 7: 106,824,157 Y123C probably damaging Het
Pcbp4 G A 9: 106,462,093 G100R probably damaging Het
Pcdh17 A G 14: 84,533,297 T1072A probably benign Het
Pcdh18 T C 3: 49,754,457 N803S probably benign Het
Ppat C T 5: 76,928,678 probably benign Het
Ppm1l T A 3: 69,317,598 L11Q probably damaging Het
Pram1 T A 17: 33,645,437 V658E probably damaging Het
Prr12 C T 7: 45,049,801 probably benign Het
Ptprq A G 10: 107,608,276 V1489A probably benign Het
Ryr1 T A 7: 29,069,115 I2817F probably damaging Het
Sall2 A G 14: 52,314,493 L413P probably damaging Het
Slc7a9 T A 7: 35,454,129 M185K probably benign Het
Stag2 C T X: 42,266,253 H1149Y possibly damaging Het
Timm10b T A 7: 105,641,091 Y64N probably damaging Het
Tmem30c T C 16: 57,266,505 T312A probably benign Het
Tmem9b G T 7: 109,745,343 C17* probably null Het
Vmn2r68 C A 7: 85,232,414 R486L probably benign Het
Xkr9 T A 1: 13,701,163 I301N probably damaging Het
Xpo7 T C 14: 70,688,264 Q446R probably damaging Het
Ythdf3 T C 3: 16,205,198 V503A possibly damaging Het
Zfp280b T A 10: 76,039,214 V309D probably damaging Het
Zfp53 T A 17: 21,509,510 C602S probably benign Het
Zfp616 A T 11: 74,083,817 N395I possibly damaging Het
Zfp644 T C 5: 106,636,001 I862M probably benign Het
Other mutations in Zfp715
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Zfp715 APN 7 43299749 missense possibly damaging 0.53
IGL00984:Zfp715 APN 7 43299784 missense probably benign 0.28
IGL03401:Zfp715 APN 7 43299736 missense probably benign 0.18
R0373:Zfp715 UTSW 7 43299336 missense possibly damaging 0.96
R1167:Zfp715 UTSW 7 43298437 missense possibly damaging 0.83
R1943:Zfp715 UTSW 7 43299630 missense possibly damaging 0.86
R1987:Zfp715 UTSW 7 43298649 missense possibly damaging 0.71
R2073:Zfp715 UTSW 7 43311120 missense probably benign 0.01
R2116:Zfp715 UTSW 7 43297946 missense possibly damaging 0.71
R2403:Zfp715 UTSW 7 43299268 missense possibly damaging 0.91
R3707:Zfp715 UTSW 7 43311129 missense probably benign
R3838:Zfp715 UTSW 7 43299756 missense probably benign 0.33
R4059:Zfp715 UTSW 7 43301731 missense probably benign 0.11
R4110:Zfp715 UTSW 7 43297880 missense possibly damaging 0.72
R4426:Zfp715 UTSW 7 43311092 missense probably damaging 0.99
R4675:Zfp715 UTSW 7 43300020 missense probably benign 0.15
R4898:Zfp715 UTSW 7 43299682 missense possibly damaging 0.48
R5477:Zfp715 UTSW 7 43299954 missense probably damaging 0.99
R5574:Zfp715 UTSW 7 43311039 missense possibly damaging 0.94
R5594:Zfp715 UTSW 7 43299692 missense possibly damaging 0.73
R5967:Zfp715 UTSW 7 43299148 missense probably benign 0.04
R6538:Zfp715 UTSW 7 43299149 missense possibly damaging 0.73
R7322:Zfp715 UTSW 7 43311138 missense possibly damaging 0.53
R7629:Zfp715 UTSW 7 43301676 missense possibly damaging 0.92
R7934:Zfp715 UTSW 7 43299884 nonsense probably null
R7973:Zfp715 UTSW 7 43299897 missense possibly damaging 0.64
R8327:Zfp715 UTSW 7 43298058 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- CACTGAAGGCTTTTCCACACAG -3'
(R):5'- GGCTCCTGTAATGCTAACTGTG -3'

Sequencing Primer
(F):5'- TGAAGGCTTTTCCACACAGAGTAC -3'
(R):5'- CCTGTAATGCTAACTGTGTGGTTAC -3'
Posted On2016-06-06