Incidental Mutation 'R0436:Cep95'
ID39021
Institutional Source Beutler Lab
Gene Symbol Cep95
Ensembl Gene ENSMUSG00000018372
Gene Namecentrosomal protein 95
SynonymsF630025I20Rik, Ccdc45, 4732496G21Rik
MMRRC Submission 038637-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R0436 (G1)
Quality Score101
Status Validated
Chromosome11
Chromosomal Location106789252-106819930 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106818685 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 109 (Q109R)
Ref Sequence ENSEMBL: ENSMUSP00000122454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018516] [ENSMUST00000092517] [ENSMUST00000103067] [ENSMUST00000103068] [ENSMUST00000124898] [ENSMUST00000139297] [ENSMUST00000167787]
Predicted Effect probably damaging
Transcript: ENSMUST00000018516
AA Change: Q815R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000018516
Gene: ENSMUSG00000018372
AA Change: Q815R

DomainStartEndE-ValueType
low complexity region 389 407 N/A INTRINSIC
coiled coil region 584 633 N/A INTRINSIC
coiled coil region 701 793 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092517
SMART Domains Protein: ENSMUSP00000090177
Gene: ENSMUSG00000018363

DomainStartEndE-ValueType
C2 13 116 1.51e-15 SMART
WW 158 190 1.96e-11 SMART
WW 252 284 2.47e-8 SMART
WW 298 330 4.97e-13 SMART
low complexity region 341 351 N/A INTRINSIC
HECTc 412 748 1.75e-165 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103067
SMART Domains Protein: ENSMUSP00000099356
Gene: ENSMUSG00000018363

DomainStartEndE-ValueType
C2 13 103 1e-6 SMART
WW 145 177 1.96e-11 SMART
WW 239 271 2.47e-8 SMART
WW 285 317 4.97e-13 SMART
low complexity region 328 338 N/A INTRINSIC
HECTc 399 735 1.75e-165 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000103068
AA Change: Q772R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099357
Gene: ENSMUSG00000018372
AA Change: Q772R

DomainStartEndE-ValueType
low complexity region 346 364 N/A INTRINSIC
coiled coil region 541 590 N/A INTRINSIC
coiled coil region 658 750 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000124898
AA Change: Q109R

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000122454
Gene: ENSMUSG00000018372
AA Change: Q109R

DomainStartEndE-ValueType
coiled coil region 7 87 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131244
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133581
Predicted Effect probably benign
Transcript: ENSMUST00000139297
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149279
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151282
Predicted Effect probably benign
Transcript: ENSMUST00000167787
SMART Domains Protein: ENSMUSP00000129269
Gene: ENSMUSG00000018363

DomainStartEndE-ValueType
C2 13 116 1.51e-15 SMART
WW 158 190 1.96e-11 SMART
WW 252 284 2.47e-8 SMART
WW 298 330 4.97e-13 SMART
low complexity region 341 351 N/A INTRINSIC
HECTc 412 748 1.75e-165 SMART
Meta Mutation Damage Score 0.2521 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.4%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik T C 4: 62,543,445 probably benign Het
Abcb10 C T 8: 123,971,001 G195S probably benign Het
Adrb2 A G 18: 62,179,553 V67A possibly damaging Het
Alx4 A T 2: 93,668,357 K145* probably null Het
Arl8a G A 1: 135,146,980 M1I probably null Het
B230118H07Rik T C 2: 101,610,519 probably benign Het
Btbd16 G A 7: 130,786,053 S134N probably benign Het
Ccdc136 T A 6: 29,414,934 L474Q probably damaging Het
Cebpz A G 17: 78,935,650 Y192H probably benign Het
Cfap54 G T 10: 93,038,975 Q520K possibly damaging Het
Cog2 C T 8: 124,548,514 probably benign Het
Cul1 A G 6: 47,523,773 N702S probably benign Het
D430041D05Rik G C 2: 104,167,950 P1836R probably damaging Het
Dmxl2 T C 9: 54,383,750 D2472G probably damaging Het
Ect2 A G 3: 27,150,095 F22L probably benign Het
Ehd4 A T 2: 120,102,341 D201E probably damaging Het
Eif4ebp3 A G 18: 36,664,301 probably null Het
Exd2 T C 12: 80,490,770 probably benign Het
Gtf2a1 A C 12: 91,568,273 probably null Het
H2-DMb1 A G 17: 34,159,656 Y256C probably damaging Het
Haus6 T C 4: 86,585,807 R527G probably benign Het
Helb C T 10: 120,094,212 probably benign Het
Hhatl C T 9: 121,788,762 A254T probably benign Het
Hk1 A T 10: 62,299,275 probably benign Het
Hmcn2 A G 2: 31,405,612 K2611R probably damaging Het
Hrc A G 7: 45,336,133 H236R possibly damaging Het
Hunk T A 16: 90,464,154 Y178N probably damaging Het
Jakmip2 G A 18: 43,558,169 Q616* probably null Het
Kcnh4 C T 11: 100,746,932 G633E probably benign Het
Msantd4 C T 9: 4,385,180 R302C probably damaging Het
Nae1 T C 8: 104,523,236 probably benign Het
Nek4 C T 14: 30,970,472 L293F probably damaging Het
Odf2l C T 3: 145,126,116 T44I possibly damaging Het
Olfr601 A G 7: 103,358,741 V151A possibly damaging Het
Otog G A 7: 46,265,936 probably benign Het
Ppp1r21 C T 17: 88,565,689 T425I possibly damaging Het
Prrc2b A G 2: 32,230,660 E2204G probably damaging Het
Prrc2c A C 1: 162,705,314 probably benign Het
Prrxl1 T C 14: 32,608,083 F81S probably damaging Het
Ptgs2 T C 1: 150,104,277 probably benign Het
Slc12a8 T A 16: 33,551,085 V197E probably damaging Het
Syne3 A G 12: 104,946,924 W593R possibly damaging Het
Tmem63a A T 1: 180,972,733 T696S probably benign Het
Tnks2 A G 19: 36,849,358 D165G possibly damaging Het
Trim43a T C 9: 88,588,187 W349R probably damaging Het
Unc45b T C 11: 82,929,567 probably benign Het
Vmn1r4 T A 6: 56,956,962 N150K probably damaging Het
Wdfy4 C A 14: 33,083,812 probably benign Het
Wdr77 T A 3: 105,960,026 D63E probably damaging Het
Zan T C 5: 137,464,902 T672A unknown Het
Zdhhc17 A T 10: 110,981,990 probably null Het
Other mutations in Cep95
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Cep95 APN 11 106818217 missense probably damaging 0.98
IGL00988:Cep95 APN 11 106806394 missense probably benign 0.00
IGL01306:Cep95 APN 11 106813815 missense probably benign 0.00
IGL01995:Cep95 APN 11 106806371 missense probably damaging 1.00
IGL02541:Cep95 APN 11 106815581 missense probably damaging 0.99
ANU23:Cep95 UTSW 11 106813815 missense probably benign 0.00
R0071:Cep95 UTSW 11 106790728 unclassified probably benign
R0071:Cep95 UTSW 11 106790728 unclassified probably benign
R0255:Cep95 UTSW 11 106811271 missense probably benign 0.10
R0427:Cep95 UTSW 11 106790752 missense probably benign 0.18
R0583:Cep95 UTSW 11 106814623 missense probably benign
R0831:Cep95 UTSW 11 106814704 missense probably benign 0.00
R1459:Cep95 UTSW 11 106817955 missense probably damaging 1.00
R1589:Cep95 UTSW 11 106800104 missense probably benign 0.00
R1627:Cep95 UTSW 11 106809705 missense probably damaging 1.00
R1768:Cep95 UTSW 11 106806351 nonsense probably null
R1914:Cep95 UTSW 11 106814638 missense probably damaging 1.00
R1915:Cep95 UTSW 11 106814638 missense probably damaging 1.00
R1928:Cep95 UTSW 11 106790728 unclassified probably benign
R2495:Cep95 UTSW 11 106809282 missense possibly damaging 0.73
R3157:Cep95 UTSW 11 106809187 splice site probably benign
R3158:Cep95 UTSW 11 106809187 splice site probably benign
R3712:Cep95 UTSW 11 106811286 nonsense probably null
R3881:Cep95 UTSW 11 106806292 missense probably damaging 0.98
R4739:Cep95 UTSW 11 106815734 missense probably benign 0.34
R4908:Cep95 UTSW 11 106811346 missense probably damaging 1.00
R4989:Cep95 UTSW 11 106816654 splice site probably null
R5913:Cep95 UTSW 11 106818509 unclassified probably benign
R5925:Cep95 UTSW 11 106812401 missense probably benign 0.00
R6291:Cep95 UTSW 11 106815596 missense probably damaging 1.00
R6540:Cep95 UTSW 11 106801502 missense probably damaging 0.97
R6924:Cep95 UTSW 11 106811197 missense probably damaging 0.99
R6985:Cep95 UTSW 11 106818703 missense probably damaging 0.99
R7156:Cep95 UTSW 11 106809224 missense possibly damaging 0.84
R7940:Cep95 UTSW 11 106796148 missense probably benign
R8348:Cep95 UTSW 11 106813767 missense possibly damaging 0.81
R8509:Cep95 UTSW 11 106805050 missense probably benign 0.08
R8849:Cep95 UTSW 11 106816804 missense
X0028:Cep95 UTSW 11 106812410 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGTCTTGGAAGGGAGCCAACAAATC -3'
(R):5'- CAACATGCTTCACAAGTGGGCTG -3'

Sequencing Primer
(F):5'- GTCACAAGCTTCAGACTGACTTAG -3'
(R):5'- GCAGGACTTGCTAACAGCTTTAAC -3'
Posted On2013-05-23