Incidental Mutation 'R5007:Olfr702'
ID390213
Institutional Source Beutler Lab
Gene Symbol Olfr702
Ensembl Gene ENSMUSG00000056863
Gene Nameolfactory receptor 702
SynonymsMOR260-4, GA_x6K02T2PBJ9-9202245-9201289
MMRRC Submission 042598-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R5007 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location106823489-106833893 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106824157 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 123 (Y123C)
Ref Sequence ENSEMBL: ENSMUSP00000151862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075414] [ENSMUST00000080899] [ENSMUST00000208864] [ENSMUST00000208895] [ENSMUST00000217739] [ENSMUST00000219803]
Predicted Effect probably benign
Transcript: ENSMUST00000075414
SMART Domains Protein: ENSMUSP00000074868
Gene: ENSMUSG00000036744

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.9e-46 PFAM
Pfam:7tm_1 41 290 2.3e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000080899
AA Change: Y123C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079704
Gene: ENSMUSG00000056863
AA Change: Y123C

DomainStartEndE-ValueType
Pfam:7tm_4 29 307 2.7e-53 PFAM
Pfam:7TM_GPCR_Srsx 35 300 2.9e-8 PFAM
Pfam:7tm_1 41 290 1.5e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000208864
AA Change: Y123C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000208895
AA Change: Y123C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000217739
Predicted Effect probably damaging
Transcript: ENSMUST00000219803
AA Change: Y123C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.5195 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 89.6%
Validation Efficiency 99% (89/90)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik C G 7: 27,578,767 T242R probably damaging Het
Abca8b T C 11: 109,936,764 T1473A probably damaging Het
Adam22 T C 5: 8,167,393 Y134C probably damaging Het
Alg9 T A 9: 50,788,224 M183K probably damaging Het
Ambra1 T C 2: 91,772,310 I213T possibly damaging Het
Ankrd55 T A 13: 112,367,932 V376D probably benign Het
Ano4 A C 10: 89,112,945 V166G probably benign Het
Aox3 T A 1: 58,163,424 C730S probably benign Het
Apc T A 18: 34,312,963 Y953N probably damaging Het
Ass1 T C 2: 31,501,532 F273S possibly damaging Het
Atg2b T C 12: 105,643,876 probably null Het
B3gnt9 A G 8: 105,254,490 Y89H probably damaging Het
Cd38 T G 5: 43,906,164 F200V probably damaging Het
Cep170 G T 1: 176,769,814 R388S probably benign Het
Col22a1 A T 15: 71,944,422 D614E probably damaging Het
Crybg3 C A 16: 59,558,100 probably benign Het
Ctdp1 A T 18: 80,420,480 S114T probably damaging Het
Dctd C T 8: 48,137,414 probably benign Het
Dmtf1 T C 5: 9,122,439 probably benign Het
Dnhd1 G A 7: 105,713,076 V3715M probably damaging Het
Dok1 A T 6: 83,032,316 L185H probably damaging Het
Dpep1 T C 8: 123,199,378 V152A probably damaging Het
Eif2ak1 G T 5: 143,873,880 R136L probably benign Het
Eml5 A T 12: 98,830,965 S1063T probably damaging Het
Fam171b T A 2: 83,855,509 L179* probably null Het
Fam213b A G 4: 154,897,074 probably null Het
Flot1 G T 17: 35,824,375 probably benign Het
Fmn2 A T 1: 174,744,300 H1491L probably damaging Het
Frem1 C T 4: 82,940,812 probably benign Het
Gdf2 A G 14: 33,944,906 D195G probably benign Het
Golga4 T G 9: 118,558,300 C1497G probably benign Het
Gpaa1 T A 15: 76,331,668 C33* probably null Het
Hectd1 A T 12: 51,802,660 C254S possibly damaging Het
Hspa1b C T 17: 34,958,110 A300T probably benign Het
Igf2bp2 A G 16: 22,079,496 I233T probably damaging Het
Iqce C A 5: 140,675,248 A491S possibly damaging Het
Irak3 A G 10: 120,146,429 probably null Het
Kcnip1 T A 11: 33,642,495 H124L probably benign Het
Klhdc10 G A 6: 30,450,641 R393Q probably benign Het
Klhl28 C T 12: 64,957,227 E171K probably damaging Het
Map2 T C 1: 66,413,289 V288A possibly damaging Het
Mdp1 C T 14: 55,659,226 R126Q probably damaging Het
Meltf A G 16: 31,887,562 D288G possibly damaging Het
Mgat4e T A 1: 134,541,152 I385F probably benign Het
Mical3 A C 6: 121,038,069 V211G probably damaging Het
Mlh1 A G 9: 111,271,410 *39R probably null Het
Mre11a A G 9: 14,809,820 D345G probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Nat1 T G 8: 67,491,425 L154R probably benign Het
Nlrp4a A G 7: 26,462,480 D851G probably damaging Het
Npas4 A C 19: 4,989,656 V54G possibly damaging Het
Pcbp4 G A 9: 106,462,093 G100R probably damaging Het
Pcdh17 A G 14: 84,533,297 T1072A probably benign Het
Pcdh18 T C 3: 49,754,457 N803S probably benign Het
Ppat C T 5: 76,928,678 probably benign Het
Ppm1l T A 3: 69,317,598 L11Q probably damaging Het
Pram1 T A 17: 33,645,437 V658E probably damaging Het
Prr12 C T 7: 45,049,801 probably benign Het
Ptprq A G 10: 107,608,276 V1489A probably benign Het
Ryr1 T A 7: 29,069,115 I2817F probably damaging Het
Sall2 A G 14: 52,314,493 L413P probably damaging Het
Slc7a9 T A 7: 35,454,129 M185K probably benign Het
Stag2 C T X: 42,266,253 H1149Y possibly damaging Het
Timm10b T A 7: 105,641,091 Y64N probably damaging Het
Tmem30c T C 16: 57,266,505 T312A probably benign Het
Tmem9b G T 7: 109,745,343 C17* probably null Het
Vmn2r68 C A 7: 85,232,414 R486L probably benign Het
Xkr9 T A 1: 13,701,163 I301N probably damaging Het
Xpo7 T C 14: 70,688,264 Q446R probably damaging Het
Ythdf3 T C 3: 16,205,198 V503A possibly damaging Het
Zfp280b T A 10: 76,039,214 V309D probably damaging Het
Zfp53 T A 17: 21,509,510 C602S probably benign Het
Zfp616 A T 11: 74,083,817 N395I possibly damaging Het
Zfp644 T C 5: 106,636,001 I862M probably benign Het
Zfp715 T C 7: 43,299,595 T314A possibly damaging Het
Other mutations in Olfr702
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01549:Olfr702 APN 7 106824029 missense probably benign 0.01
IGL02120:Olfr702 APN 7 106823698 missense possibly damaging 0.94
R0025:Olfr702 UTSW 7 106823756 missense possibly damaging 0.74
R1213:Olfr702 UTSW 7 106824197 missense possibly damaging 0.48
R1830:Olfr702 UTSW 7 106824110 missense probably benign 0.00
R2216:Olfr702 UTSW 7 106823998 missense probably damaging 0.99
R2571:Olfr702 UTSW 7 106823726 missense probably benign 0.09
R2876:Olfr702 UTSW 7 106824457 missense probably benign 0.07
R2920:Olfr702 UTSW 7 106824364 missense probably benign 0.11
R4082:Olfr702 UTSW 7 106824038 missense possibly damaging 0.78
R4130:Olfr702 UTSW 7 106823585 missense probably benign 0.01
R4750:Olfr702 UTSW 7 106824307 missense probably damaging 0.98
R5117:Olfr702 UTSW 7 106823662 missense probably damaging 0.99
R5908:Olfr702 UTSW 7 106824197 missense probably benign 0.09
R6824:Olfr702 UTSW 7 106824457 missense probably benign 0.00
R7193:Olfr702 UTSW 7 106824591 start gained probably benign
R7254:Olfr702 UTSW 7 106823570 makesense probably null
R7827:Olfr702 UTSW 7 106823725 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTGAAGCCAGCTTTAGGAGG -3'
(R):5'- TCGACTTCATACACCCATGTAC -3'

Sequencing Primer
(F):5'- CCAGCTTTAGGAGGGCAGG -3'
(R):5'- CCTCAAAAACTTATCCTTTGCTGAC -3'
Posted On2016-06-06