Incidental Mutation 'R0436:Gtf2a1'
ID39023
Institutional Source Beutler Lab
Gene Symbol Gtf2a1
Ensembl Gene ENSMUSG00000020962
Gene Namegeneral transcription factor II A, 1
SynonymsTfiia1, TfIIAa/b, 19kDa, 37kDa, 6330549H03Rik
MMRRC Submission 038637-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0436 (G1)
Quality Score123
Status Validated
Chromosome12
Chromosomal Location91555262-91590487 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to C at 91568273 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000068562 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021345] [ENSMUST00000063314]
Predicted Effect probably null
Transcript: ENSMUST00000021345
SMART Domains Protein: ENSMUSP00000021345
Gene: ENSMUSG00000020962

DomainStartEndE-ValueType
TFIIA 12 378 5.47e-146 SMART
Predicted Effect probably null
Transcript: ENSMUST00000063314
SMART Domains Protein: ENSMUSP00000068562
Gene: ENSMUSG00000020962

DomainStartEndE-ValueType
Pfam:TFIIA 1 339 9.3e-68 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.4%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Accurate transcription initiation on TATA-containing class II genes involves the ordered assembly of RNA polymerase II (POLR2A; MIM 180660) and several general initiation factors (summarized by DeJong and Roeder, 1993 [PubMed 8224848]). One of these factors is TFIIA, which when purified from HeLa extracts consists of 35-, 19-, and 12-kD subunits.[supplied by OMIM, Jul 2010]
PHENOTYPE: Mice homozygous for a hypomorphic allele where D/G cleavage residues are replaced with noncleavable A/A show neonatal lethality, feeding defects, low testis weight, and male infertility associated with azoospermia, small seminiferous tubules, lack of elongating spermatids, and increased apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik T C 4: 62,543,445 probably benign Het
Abcb10 C T 8: 123,971,001 G195S probably benign Het
Adrb2 A G 18: 62,179,553 V67A possibly damaging Het
Alx4 A T 2: 93,668,357 K145* probably null Het
Arl8a G A 1: 135,146,980 M1I probably null Het
B230118H07Rik T C 2: 101,610,519 probably benign Het
Btbd16 G A 7: 130,786,053 S134N probably benign Het
Ccdc136 T A 6: 29,414,934 L474Q probably damaging Het
Cebpz A G 17: 78,935,650 Y192H probably benign Het
Cep95 A G 11: 106,818,685 Q109R probably null Het
Cfap54 G T 10: 93,038,975 Q520K possibly damaging Het
Cog2 C T 8: 124,548,514 probably benign Het
Cul1 A G 6: 47,523,773 N702S probably benign Het
D430041D05Rik G C 2: 104,167,950 P1836R probably damaging Het
Dmxl2 T C 9: 54,383,750 D2472G probably damaging Het
Ect2 A G 3: 27,150,095 F22L probably benign Het
Ehd4 A T 2: 120,102,341 D201E probably damaging Het
Eif4ebp3 A G 18: 36,664,301 probably null Het
Exd2 T C 12: 80,490,770 probably benign Het
H2-DMb1 A G 17: 34,159,656 Y256C probably damaging Het
Haus6 T C 4: 86,585,807 R527G probably benign Het
Helb C T 10: 120,094,212 probably benign Het
Hhatl C T 9: 121,788,762 A254T probably benign Het
Hk1 A T 10: 62,299,275 probably benign Het
Hmcn2 A G 2: 31,405,612 K2611R probably damaging Het
Hrc A G 7: 45,336,133 H236R possibly damaging Het
Hunk T A 16: 90,464,154 Y178N probably damaging Het
Jakmip2 G A 18: 43,558,169 Q616* probably null Het
Kcnh4 C T 11: 100,746,932 G633E probably benign Het
Msantd4 C T 9: 4,385,180 R302C probably damaging Het
Nae1 T C 8: 104,523,236 probably benign Het
Nek4 C T 14: 30,970,472 L293F probably damaging Het
Odf2l C T 3: 145,126,116 T44I possibly damaging Het
Olfr601 A G 7: 103,358,741 V151A possibly damaging Het
Otog G A 7: 46,265,936 probably benign Het
Ppp1r21 C T 17: 88,565,689 T425I possibly damaging Het
Prrc2b A G 2: 32,230,660 E2204G probably damaging Het
Prrc2c A C 1: 162,705,314 probably benign Het
Prrxl1 T C 14: 32,608,083 F81S probably damaging Het
Ptgs2 T C 1: 150,104,277 probably benign Het
Slc12a8 T A 16: 33,551,085 V197E probably damaging Het
Syne3 A G 12: 104,946,924 W593R possibly damaging Het
Tmem63a A T 1: 180,972,733 T696S probably benign Het
Tnks2 A G 19: 36,849,358 D165G possibly damaging Het
Trim43a T C 9: 88,588,187 W349R probably damaging Het
Unc45b T C 11: 82,929,567 probably benign Het
Vmn1r4 T A 6: 56,956,962 N150K probably damaging Het
Wdfy4 C A 14: 33,083,812 probably benign Het
Wdr77 T A 3: 105,960,026 D63E probably damaging Het
Zan T C 5: 137,464,902 T672A unknown Het
Zdhhc17 A T 10: 110,981,990 probably null Het
Other mutations in Gtf2a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01510:Gtf2a1 APN 12 91567833 missense probably benign 0.00
IGL02561:Gtf2a1 APN 12 91575753 missense possibly damaging 0.93
IGL03035:Gtf2a1 APN 12 91572637 splice site probably benign
PIT4618001:Gtf2a1 UTSW 12 91567769 missense probably benign 0.09
R1595:Gtf2a1 UTSW 12 91589549 missense probably damaging 0.98
R2240:Gtf2a1 UTSW 12 91586739 missense possibly damaging 0.87
R4020:Gtf2a1 UTSW 12 91572577 missense possibly damaging 0.92
R4043:Gtf2a1 UTSW 12 91575667 missense probably benign 0.00
R4044:Gtf2a1 UTSW 12 91575667 missense probably benign 0.00
R4095:Gtf2a1 UTSW 12 91575637 missense possibly damaging 0.68
R4584:Gtf2a1 UTSW 12 91562926 missense possibly damaging 0.66
R4585:Gtf2a1 UTSW 12 91562926 missense possibly damaging 0.66
R4952:Gtf2a1 UTSW 12 91575749 missense possibly damaging 0.70
R5465:Gtf2a1 UTSW 12 91567791 missense possibly damaging 0.86
R5566:Gtf2a1 UTSW 12 91567594 missense possibly damaging 0.63
R7055:Gtf2a1 UTSW 12 91586749 missense possibly damaging 0.93
R7220:Gtf2a1 UTSW 12 91567724 missense probably benign 0.00
R7282:Gtf2a1 UTSW 12 91567835 missense possibly damaging 0.56
R7459:Gtf2a1 UTSW 12 91575652 missense probably benign 0.00
R7484:Gtf2a1 UTSW 12 91562973 missense probably benign 0.01
X0063:Gtf2a1 UTSW 12 91572612 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- ACTGCTGCACACCTATTAACTTGTCTG -3'
(R):5'- GAACAACTGCTGAAATGTGTGATCCTG -3'

Sequencing Primer
(F):5'- ACCTATTAACTTGTCTGGGGGAAAG -3'
(R):5'- tcccaggaagagtagccag -3'
Posted On2013-05-23