Incidental Mutation 'R0436:Syne3'
ID39024
Institutional Source Beutler Lab
Gene Symbol Syne3
Ensembl Gene ENSMUSG00000054150
Gene Namespectrin repeat containing, nuclear envelope family member 3
Synonyms4831426I19Rik, nesprin-3, nesprin-3alpha, nesprin-3beta
MMRRC Submission 038637-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0436 (G1)
Quality Score151
Status Validated
Chromosome12
Chromosomal Location104929933-105009809 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104946924 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 593 (W593R)
Ref Sequence ENSEMBL: ENSMUSP00000105553 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067005] [ENSMUST00000095439] [ENSMUST00000109927]
Predicted Effect possibly damaging
Transcript: ENSMUST00000067005
AA Change: W593R

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000065771
Gene: ENSMUSG00000054150
AA Change: W593R

DomainStartEndE-ValueType
Blast:SPEC 29 127 8e-24 BLAST
SPEC 136 237 1.01e-1 SMART
Blast:SPEC 252 446 9e-55 BLAST
low complexity region 447 459 N/A INTRINSIC
low complexity region 495 514 N/A INTRINSIC
SPEC 563 664 1.74e-1 SMART
Blast:SPEC 722 818 1e-12 BLAST
KASH 832 888 7.52e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095439
AA Change: W680R

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000093090
Gene: ENSMUSG00000054150
AA Change: W680R

DomainStartEndE-ValueType
SPEC 7 109 1.22e-1 SMART
SPEC 223 324 1.01e-1 SMART
Blast:SPEC 339 533 2e-54 BLAST
low complexity region 534 546 N/A INTRINSIC
low complexity region 582 601 N/A INTRINSIC
SPEC 650 751 1.74e-1 SMART
Blast:SPEC 809 905 1e-12 BLAST
KASH 919 975 7.52e-24 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109927
AA Change: W593R

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000105553
Gene: ENSMUSG00000054150
AA Change: W593R

DomainStartEndE-ValueType
Blast:SPEC 29 127 8e-24 BLAST
SPEC 136 237 1.01e-1 SMART
Blast:SPEC 252 446 9e-55 BLAST
low complexity region 447 459 N/A INTRINSIC
low complexity region 495 514 N/A INTRINSIC
SPEC 563 664 1.74e-1 SMART
Blast:SPEC 722 818 1e-12 BLAST
KASH 832 888 7.52e-24 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.4%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik T C 4: 62,543,445 probably benign Het
Abcb10 C T 8: 123,971,001 G195S probably benign Het
Adrb2 A G 18: 62,179,553 V67A possibly damaging Het
Alx4 A T 2: 93,668,357 K145* probably null Het
Arl8a G A 1: 135,146,980 M1I probably null Het
B230118H07Rik T C 2: 101,610,519 probably benign Het
Btbd16 G A 7: 130,786,053 S134N probably benign Het
Ccdc136 T A 6: 29,414,934 L474Q probably damaging Het
Cebpz A G 17: 78,935,650 Y192H probably benign Het
Cep95 A G 11: 106,818,685 Q109R probably null Het
Cfap54 G T 10: 93,038,975 Q520K possibly damaging Het
Cog2 C T 8: 124,548,514 probably benign Het
Cul1 A G 6: 47,523,773 N702S probably benign Het
D430041D05Rik G C 2: 104,167,950 P1836R probably damaging Het
Dmxl2 T C 9: 54,383,750 D2472G probably damaging Het
Ect2 A G 3: 27,150,095 F22L probably benign Het
Ehd4 A T 2: 120,102,341 D201E probably damaging Het
Eif4ebp3 A G 18: 36,664,301 probably null Het
Exd2 T C 12: 80,490,770 probably benign Het
Gtf2a1 A C 12: 91,568,273 probably null Het
H2-DMb1 A G 17: 34,159,656 Y256C probably damaging Het
Haus6 T C 4: 86,585,807 R527G probably benign Het
Helb C T 10: 120,094,212 probably benign Het
Hhatl C T 9: 121,788,762 A254T probably benign Het
Hk1 A T 10: 62,299,275 probably benign Het
Hmcn2 A G 2: 31,405,612 K2611R probably damaging Het
Hrc A G 7: 45,336,133 H236R possibly damaging Het
Hunk T A 16: 90,464,154 Y178N probably damaging Het
Jakmip2 G A 18: 43,558,169 Q616* probably null Het
Kcnh4 C T 11: 100,746,932 G633E probably benign Het
Msantd4 C T 9: 4,385,180 R302C probably damaging Het
Nae1 T C 8: 104,523,236 probably benign Het
Nek4 C T 14: 30,970,472 L293F probably damaging Het
Odf2l C T 3: 145,126,116 T44I possibly damaging Het
Olfr601 A G 7: 103,358,741 V151A possibly damaging Het
Otog G A 7: 46,265,936 probably benign Het
Ppp1r21 C T 17: 88,565,689 T425I possibly damaging Het
Prrc2b A G 2: 32,230,660 E2204G probably damaging Het
Prrc2c A C 1: 162,705,314 probably benign Het
Prrxl1 T C 14: 32,608,083 F81S probably damaging Het
Ptgs2 T C 1: 150,104,277 probably benign Het
Slc12a8 T A 16: 33,551,085 V197E probably damaging Het
Tmem63a A T 1: 180,972,733 T696S probably benign Het
Tnks2 A G 19: 36,849,358 D165G possibly damaging Het
Trim43a T C 9: 88,588,187 W349R probably damaging Het
Unc45b T C 11: 82,929,567 probably benign Het
Vmn1r4 T A 6: 56,956,962 N150K probably damaging Het
Wdfy4 C A 14: 33,083,812 probably benign Het
Wdr77 T A 3: 105,960,026 D63E probably damaging Het
Zan T C 5: 137,464,902 T672A unknown Het
Zdhhc17 A T 10: 110,981,990 probably null Het
Other mutations in Syne3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01154:Syne3 APN 12 104958069 missense probably benign 0.00
IGL01986:Syne3 APN 12 104968000 missense probably damaging 1.00
IGL02303:Syne3 APN 12 104963294 missense probably damaging 1.00
IGL02469:Syne3 APN 12 104954306 missense probably benign 0.08
IGL03127:Syne3 APN 12 104943428 missense probably benign 0.02
BB008:Syne3 UTSW 12 104963232 missense probably damaging 0.97
BB018:Syne3 UTSW 12 104963232 missense probably damaging 0.97
PIT4791001:Syne3 UTSW 12 104963179 missense probably benign
R0471:Syne3 UTSW 12 104943426 missense probably benign 0.00
R0613:Syne3 UTSW 12 104958112 missense probably benign
R0662:Syne3 UTSW 12 104961510 missense probably benign 0.44
R0707:Syne3 UTSW 12 104969360 missense probably damaging 0.98
R1321:Syne3 UTSW 12 104975796 missense probably benign 0.14
R1494:Syne3 UTSW 12 104955582 missense possibly damaging 0.87
R2035:Syne3 UTSW 12 104958127 missense probably benign 0.00
R2147:Syne3 UTSW 12 104953098 missense probably damaging 1.00
R2326:Syne3 UTSW 12 104969234 missense probably damaging 1.00
R2923:Syne3 UTSW 12 104968084 missense probably damaging 1.00
R3710:Syne3 UTSW 12 104943438 missense possibly damaging 0.86
R3946:Syne3 UTSW 12 104958066 missense probably damaging 1.00
R4542:Syne3 UTSW 12 104969244 missense probably benign 0.00
R4544:Syne3 UTSW 12 104959469 missense probably damaging 1.00
R5110:Syne3 UTSW 12 104943370 missense probably benign 0.10
R5256:Syne3 UTSW 12 104975880 start codon destroyed probably null 1.00
R5490:Syne3 UTSW 12 104955672 missense probably damaging 1.00
R5616:Syne3 UTSW 12 104955678 missense probably damaging 1.00
R5730:Syne3 UTSW 12 104961454 missense probably benign 0.02
R5941:Syne3 UTSW 12 104946992 missense probably benign
R6208:Syne3 UTSW 12 104943363 missense probably benign 0.12
R6456:Syne3 UTSW 12 104940704 missense possibly damaging 0.87
R6566:Syne3 UTSW 12 104946707 missense probably benign 0.00
R6957:Syne3 UTSW 12 104954302 missense probably damaging 1.00
R7251:Syne3 UTSW 12 104961571 frame shift probably null
R7388:Syne3 UTSW 12 104967908 missense probably damaging 1.00
R7591:Syne3 UTSW 12 104940604 critical splice donor site probably null
R7614:Syne3 UTSW 12 104946642 missense not run
R7740:Syne3 UTSW 12 104954287 missense probably benign 0.01
R7763:Syne3 UTSW 12 104997495 start gained probably benign
R7931:Syne3 UTSW 12 104963232 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CAGACAGCAGCGTCTATGGGAAAC -3'
(R):5'- TTCACAGAGCACCACAGTGGATGG -3'

Sequencing Primer
(F):5'- CGTCTATGGGAAACATGAGTGTG -3'
(R):5'- ggggaaggattgtaggaggg -3'
Posted On2013-05-23