Mutagenetix > Incidental Mutation

Incidental Mutation 'R5007:Sall2'

390240

Institutional Source

Beutler Lab

Gene Symbol

Sall2

Ensembl Gene

ENSMUSG00000049532

Gene Name

spalt like transcription factor 2

Synonyms

Msal-2

MMRRC Submission

042598-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5007 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

52311172-52328762 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 52314493 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 413 (L413P)

Ref Sequence

ENSEMBL: ENSMUSP00000154331 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058326] [ENSMUST00000135523]

AlphaFold

Q9QX96

Predicted Effect

probably damaging
Transcript: ENSMUST00000058326
AA Change: L415P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000056401
Gene: ENSMUSG00000049532
AA Change: L415P

Domain	Start	End	E-Value	Type
low complexity region	71	81	N/A	INTRINSIC
low complexity region	97	110	N/A	INTRINSIC
low complexity region	128	139	N/A	INTRINSIC
low complexity region	151	170	N/A	INTRINSIC
ZnF_C2H2	372	394	2.57e-3	SMART
ZnF_C2H2	400	422	1.28e-3	SMART
low complexity region	476	501	N/A	INTRINSIC
low complexity region	602	627	N/A	INTRINSIC
ZnF_C2H2	629	651	1.2e1	SMART
ZnF_C2H2	657	679	1.69e-3	SMART
ZnF_C2H2	689	711	6.88e-4	SMART
low complexity region	719	730	N/A	INTRINSIC
low complexity region	747	779	N/A	INTRINSIC
low complexity region	799	819	N/A	INTRINSIC
low complexity region	829	848	N/A	INTRINSIC
ZnF_C2H2	908	930	2.09e-3	SMART
ZnF_C2H2	937	960	1.01e-1	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000135523
AA Change: L413P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.8943

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.6%
20x: 89.6%

Validation Efficiency

99% (89/90)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing multiple zinc finger domains. The encoded protein functions in optical fissure closure during development of the eye in the embryo. Mutations in this gene are associated with ocular coloboma. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutation of this gene results in no apparent abnormal phenotypes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310022A10Rik	C	G	7: 27,578,767	T242R	probably damaging	Het
Abca8b	T	C	11: 109,936,764	T1473A	probably damaging	Het
Adam22	T	C	5: 8,167,393	Y134C	probably damaging	Het
Alg9	T	A	9: 50,788,224	M183K	probably damaging	Het
Ambra1	T	C	2: 91,772,310	I213T	possibly damaging	Het
Ankrd55	T	A	13: 112,367,932	V376D	probably benign	Het
Ano4	A	C	10: 89,112,945	V166G	probably benign	Het
Aox3	T	A	1: 58,163,424	C730S	probably benign	Het
Apc	T	A	18: 34,312,963	Y953N	probably damaging	Het
Ass1	T	C	2: 31,501,532	F273S	possibly damaging	Het
Atg2b	T	C	12: 105,643,876		probably null	Het
B3gnt9	A	G	8: 105,254,490	Y89H	probably damaging	Het
Cd38	T	G	5: 43,906,164	F200V	probably damaging	Het
Cep170	G	T	1: 176,769,814	R388S	probably benign	Het
Col22a1	A	T	15: 71,944,422	D614E	probably damaging	Het
Crybg3	C	A	16: 59,558,100		probably benign	Het
Ctdp1	A	T	18: 80,420,480	S114T	probably damaging	Het
Dctd	C	T	8: 48,137,414		probably benign	Het
Dmtf1	T	C	5: 9,122,439		probably benign	Het
Dnhd1	G	A	7: 105,713,076	V3715M	probably damaging	Het
Dok1	A	T	6: 83,032,316	L185H	probably damaging	Het
Dpep1	T	C	8: 123,199,378	V152A	probably damaging	Het
Eif2ak1	G	T	5: 143,873,880	R136L	probably benign	Het
Eml5	A	T	12: 98,830,965	S1063T	probably damaging	Het
Fam171b	T	A	2: 83,855,509	L179*	probably null	Het
Fam213b	A	G	4: 154,897,074		probably null	Het
Flot1	G	T	17: 35,824,375		probably benign	Het
Fmn2	A	T	1: 174,744,300	H1491L	probably damaging	Het
Frem1	C	T	4: 82,940,812		probably benign	Het
Gdf2	A	G	14: 33,944,906	D195G	probably benign	Het
Golga4	T	G	9: 118,558,300	C1497G	probably benign	Het
Gpaa1	T	A	15: 76,331,668	C33*	probably null	Het
Hectd1	A	T	12: 51,802,660	C254S	possibly damaging	Het
Hspa1b	C	T	17: 34,958,110	A300T	probably benign	Het
Igf2bp2	A	G	16: 22,079,496	I233T	probably damaging	Het
Iqce	C	A	5: 140,675,248	A491S	possibly damaging	Het
Irak3	A	G	10: 120,146,429		probably null	Het
Kcnip1	T	A	11: 33,642,495	H124L	probably benign	Het
Klhdc10	G	A	6: 30,450,641	R393Q	probably benign	Het
Klhl28	C	T	12: 64,957,227	E171K	probably damaging	Het
Map2	T	C	1: 66,413,289	V288A	possibly damaging	Het
Mdp1	C	T	14: 55,659,226	R126Q	probably damaging	Het
Meltf	A	G	16: 31,887,562	D288G	possibly damaging	Het
Mgat4e	T	A	1: 134,541,152	I385F	probably benign	Het
Mical3	A	C	6: 121,038,069	V211G	probably damaging	Het
Mlh1	A	G	9: 111,271,410	*39R	probably null	Het
Mre11a	A	G	9: 14,809,820	D345G	probably benign	Het
Mroh2a	GCCC	GC	1: 88,232,257		probably null	Het
Msh2	C	A	17: 87,723,413	A906E	probably benign	Het
Nat1	T	G	8: 67,491,425	L154R	probably benign	Het
Nlrp4a	A	G	7: 26,462,480	D851G	probably damaging	Het
Npas4	A	C	19: 4,989,656	V54G	possibly damaging	Het
Olfr702	T	C	7: 106,824,157	Y123C	probably damaging	Het
Pcbp4	G	A	9: 106,462,093	G100R	probably damaging	Het
Pcdh17	A	G	14: 84,533,297	T1072A	probably benign	Het
Pcdh18	T	C	3: 49,754,457	N803S	probably benign	Het
Ppat	C	T	5: 76,928,678		probably benign	Het
Ppm1l	T	A	3: 69,317,598	L11Q	probably damaging	Het
Pram1	T	A	17: 33,645,437	V658E	probably damaging	Het
Prr12	C	T	7: 45,049,801		probably benign	Het
Ptprq	A	G	10: 107,608,276	V1489A	probably benign	Het
Ryr1	T	A	7: 29,069,115	I2817F	probably damaging	Het
Slc7a9	T	A	7: 35,454,129	M185K	probably benign	Het
Stag2	C	T	X: 42,266,253	H1149Y	possibly damaging	Het
Timm10b	T	A	7: 105,641,091	Y64N	probably damaging	Het
Tmem30c	T	C	16: 57,266,505	T312A	probably benign	Het
Tmem9b	G	T	7: 109,745,343	C17*	probably null	Het
Vmn2r68	C	A	7: 85,232,414	R486L	probably benign	Het
Xkr9	T	A	1: 13,701,163	I301N	probably damaging	Het
Xpo7	T	C	14: 70,688,264	Q446R	probably damaging	Het
Ythdf3	T	C	3: 16,205,198	V503A	possibly damaging	Het
Zfp280b	T	A	10: 76,039,214	V309D	probably damaging	Het
Zfp53	T	A	17: 21,509,510	C602S	probably benign	Het
Zfp616	A	T	11: 74,083,817	N395I	possibly damaging	Het
Zfp644	T	C	5: 106,636,001	I862M	probably benign	Het
Zfp715	T	C	7: 43,299,595	T314A	possibly damaging	Het

Other mutations in Sall2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01587:Sall2	APN	14	52314571	missense	probably damaging	1.00
IGL02152:Sall2	APN	14	52315514	missense	probably damaging	1.00
IGL02318:Sall2	APN	14	52315565	missense	probably damaging	1.00
IGL02933:Sall2	APN	14	52313027	missense	probably benign	0.00
IGL03165:Sall2	APN	14	52314168	missense	probably damaging	1.00
R1079:Sall2	UTSW	14	52313203	missense	probably benign	0.13
R1295:Sall2	UTSW	14	52313725	missense	probably damaging	1.00
R1674:Sall2	UTSW	14	52313836	missense	probably damaging	1.00
R1840:Sall2	UTSW	14	52313725	missense	probably damaging	1.00
R1989:Sall2	UTSW	14	52314439	missense	probably damaging	1.00
R2339:Sall2	UTSW	14	52313356	missense	probably damaging	1.00
R3407:Sall2	UTSW	14	52328104	missense	probably benign	0.03
R3870:Sall2	UTSW	14	52313994	missense	probably damaging	1.00
R3895:Sall2	UTSW	14	52314047	missense	probably damaging	0.99
R4059:Sall2	UTSW	14	52314571	missense	probably damaging	1.00
R4272:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4273:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4275:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4289:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4503:Sall2	UTSW	14	52313459	missense	probably benign
R4592:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4611:Sall2	UTSW	14	52313753	missense	probably damaging	1.00
R4615:Sall2	UTSW	14	52312750	missense	probably benign	0.20
R4640:Sall2	UTSW	14	52315159	missense	probably damaging	0.99
R4693:Sall2	UTSW	14	52314478	missense	probably damaging	1.00
R4921:Sall2	UTSW	14	52315393	missense	possibly damaging	0.93
R5015:Sall2	UTSW	14	52315655	missense	possibly damaging	0.92
R5079:Sall2	UTSW	14	52314754	missense	probably damaging	1.00
R5419:Sall2	UTSW	14	52313129	missense	probably damaging	1.00
R5849:Sall2	UTSW	14	52314247	missense	probably benign	0.13
R6229:Sall2	UTSW	14	52313191	missense	probably benign
R6397:Sall2	UTSW	14	52315153	missense	probably damaging	1.00
R6422:Sall2	UTSW	14	52312724	makesense	probably null
R6456:Sall2	UTSW	14	52313593	missense	probably damaging	1.00
R6456:Sall2	UTSW	14	52313594	nonsense	probably null
R6786:Sall2	UTSW	14	52314621	missense	probably damaging	1.00
R7293:Sall2	UTSW	14	52314411	nonsense	probably null
R7496:Sall2	UTSW	14	52315561	missense	possibly damaging	0.63
R7792:Sall2	UTSW	14	52316064	missense	probably damaging	1.00
R8324:Sall2	UTSW	14	52312886	missense	probably benign	0.30
R9017:Sall2	UTSW	14	52313262	missense	possibly damaging	0.51
R9149:Sall2	UTSW	14	52313216	missense	possibly damaging	0.95
R9362:Sall2	UTSW	14	52313144	nonsense	probably null
R9571:Sall2	UTSW	14	52314373	missense	probably damaging	1.00
R9574:Sall2	UTSW	14	52314160	missense	probably damaging	1.00
R9641:Sall2	UTSW	14	52313425	missense	probably damaging	1.00
R9648:Sall2	UTSW	14	52313767	missense	probably damaging	1.00
R9694:Sall2	UTSW	14	52314667	missense	possibly damaging	0.63

Predicted Primers

PCR Primer
(F):5'- TTGTTGAAAGTAGGGAGCCC -3'
(R):5'- GCTATGGGGAAGTGATCAGTTC -3'

Sequencing Primer
(F):5'- CACTAGGGGTTTGCGTTCAACAC -3'
(R):5'- GTGATCAGTTCCTTGGAGAAACCC -3'

Posted On

2016-06-06