Incidental Mutation 'R5007:Npas4'
ID 390257
Institutional Source Beutler Lab
Gene Symbol Npas4
Ensembl Gene ENSMUSG00000045903
Gene Name neuronal PAS domain protein 4
Synonyms Nxf, LE-PAS, Npas4
MMRRC Submission 042598-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.636) question?
Stock # R5007 (G1)
Quality Score 186
Status Validated
Chromosome 19
Chromosomal Location 5034383-5040344 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 5039684 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 54 (V54G)
Ref Sequence ENSEMBL: ENSMUSP00000062992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056129]
AlphaFold Q8BGD7
Predicted Effect possibly damaging
Transcript: ENSMUST00000056129
AA Change: V54G

PolyPhen 2 Score 0.608 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000062992
Gene: ENSMUSG00000045903
AA Change: V54G

DomainStartEndE-ValueType
Blast:HLH 6 56 1e-26 BLAST
low complexity region 57 69 N/A INTRINSIC
PAS 72 140 1.88e-6 SMART
low complexity region 197 211 N/A INTRINSIC
PAS 213 273 5.66e-1 SMART
internal_repeat_1 394 473 1.35e-6 PROSPERO
internal_repeat_1 467 556 1.35e-6 PROSPERO
low complexity region 657 676 N/A INTRINSIC
Meta Mutation Damage Score 0.1815 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 89.6%
Validation Efficiency 99% (89/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NXF is a member of the basic helix-loop-helix-PER (MIM 602260)-ARNT (MIM 126110)-SIM (see SIM2; MIM 600892) (bHLH-PAS) class of transcriptional regulators, which are involved in a wide range of physiologic and developmental events (Ooe et al., 2004 [PubMed 14701734]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit hyperactivity, seizures and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik C G 7: 27,278,192 (GRCm39) T242R probably damaging Het
Abca8b T C 11: 109,827,590 (GRCm39) T1473A probably damaging Het
Adam22 T C 5: 8,217,393 (GRCm39) Y134C probably damaging Het
Alg9 T A 9: 50,699,524 (GRCm39) M183K probably damaging Het
Ambra1 T C 2: 91,602,655 (GRCm39) I213T possibly damaging Het
Ankrd55 T A 13: 112,504,466 (GRCm39) V376D probably benign Het
Ano4 A C 10: 88,948,807 (GRCm39) V166G probably benign Het
Aox3 T A 1: 58,202,583 (GRCm39) C730S probably benign Het
Apc T A 18: 34,446,016 (GRCm39) Y953N probably damaging Het
Ass1 T C 2: 31,391,544 (GRCm39) F273S possibly damaging Het
Atg2b T C 12: 105,610,135 (GRCm39) probably null Het
B3gnt9 A G 8: 105,981,122 (GRCm39) Y89H probably damaging Het
Cd38 T G 5: 44,063,506 (GRCm39) F200V probably damaging Het
Cep170 G T 1: 176,597,380 (GRCm39) R388S probably benign Het
Col22a1 A T 15: 71,816,271 (GRCm39) D614E probably damaging Het
Crybg3 C A 16: 59,378,463 (GRCm39) probably benign Het
Ctdp1 A T 18: 80,463,695 (GRCm39) S114T probably damaging Het
Dctd C T 8: 48,590,449 (GRCm39) probably benign Het
Dmtf1 T C 5: 9,172,439 (GRCm39) probably benign Het
Dnhd1 G A 7: 105,362,283 (GRCm39) V3715M probably damaging Het
Dok1 A T 6: 83,009,297 (GRCm39) L185H probably damaging Het
Dpep1 T C 8: 123,926,117 (GRCm39) V152A probably damaging Het
Eif2ak1 G T 5: 143,810,698 (GRCm39) R136L probably benign Het
Eml5 A T 12: 98,797,224 (GRCm39) S1063T probably damaging Het
Fam171b T A 2: 83,685,853 (GRCm39) L179* probably null Het
Flot1 G T 17: 36,135,267 (GRCm39) probably benign Het
Fmn2 A T 1: 174,571,866 (GRCm39) H1491L probably damaging Het
Frem1 C T 4: 82,859,049 (GRCm39) probably benign Het
Gdf2 A G 14: 33,666,863 (GRCm39) D195G probably benign Het
Golga4 T G 9: 118,387,368 (GRCm39) C1497G probably benign Het
Gpaa1 T A 15: 76,215,868 (GRCm39) C33* probably null Het
Hectd1 A T 12: 51,849,443 (GRCm39) C254S possibly damaging Het
Hspa1b C T 17: 35,177,086 (GRCm39) A300T probably benign Het
Igf2bp2 A G 16: 21,898,246 (GRCm39) I233T probably damaging Het
Iqce C A 5: 140,661,003 (GRCm39) A491S possibly damaging Het
Irak3 A G 10: 119,982,334 (GRCm39) probably null Het
Kcnip1 T A 11: 33,592,495 (GRCm39) H124L probably benign Het
Klhdc10 G A 6: 30,450,640 (GRCm39) R393Q probably benign Het
Klhl28 C T 12: 65,004,001 (GRCm39) E171K probably damaging Het
Map2 T C 1: 66,452,448 (GRCm39) V288A possibly damaging Het
Mdp1 C T 14: 55,896,683 (GRCm39) R126Q probably damaging Het
Meltf A G 16: 31,706,380 (GRCm39) D288G possibly damaging Het
Mgat4e T A 1: 134,468,890 (GRCm39) I385F probably benign Het
Mical3 A C 6: 121,015,030 (GRCm39) V211G probably damaging Het
Mlh1 A G 9: 111,100,478 (GRCm39) *39R probably null Het
Mre11a A G 9: 14,721,116 (GRCm39) D345G probably benign Het
Mroh2a GCCC GC 1: 88,159,979 (GRCm39) probably null Het
Msh2 C A 17: 88,030,841 (GRCm39) A906E probably benign Het
Nat1 T G 8: 67,944,077 (GRCm39) L154R probably benign Het
Nlrp4a A G 7: 26,161,905 (GRCm39) D851G probably damaging Het
Or13n4 T C 7: 106,423,364 (GRCm39) Y123C probably damaging Het
Pcbp4 G A 9: 106,339,292 (GRCm39) G100R probably damaging Het
Pcdh17 A G 14: 84,770,737 (GRCm39) T1072A probably benign Het
Pcdh18 T C 3: 49,708,906 (GRCm39) N803S probably benign Het
Ppat C T 5: 77,076,525 (GRCm39) probably benign Het
Ppm1l T A 3: 69,224,931 (GRCm39) L11Q probably damaging Het
Pram1 T A 17: 33,864,411 (GRCm39) V658E probably damaging Het
Prr12 C T 7: 44,699,225 (GRCm39) probably benign Het
Prxl2b A G 4: 154,981,531 (GRCm39) probably null Het
Ptprq A G 10: 107,444,137 (GRCm39) V1489A probably benign Het
Ryr1 T A 7: 28,768,540 (GRCm39) I2817F probably damaging Het
Sall2 A G 14: 52,551,950 (GRCm39) L413P probably damaging Het
Slc7a9 T A 7: 35,153,554 (GRCm39) M185K probably benign Het
Stag2 C T X: 41,355,130 (GRCm39) H1149Y possibly damaging Het
Timm10b T A 7: 105,290,298 (GRCm39) Y64N probably damaging Het
Tmem30c T C 16: 57,086,868 (GRCm39) T312A probably benign Het
Tmem9b G T 7: 109,344,550 (GRCm39) C17* probably null Het
Vmn2r68 C A 7: 84,881,622 (GRCm39) R486L probably benign Het
Xkr9 T A 1: 13,771,387 (GRCm39) I301N probably damaging Het
Xpo7 T C 14: 70,925,704 (GRCm39) Q446R probably damaging Het
Ythdf3 T C 3: 16,259,362 (GRCm39) V503A possibly damaging Het
Zfp280b T A 10: 75,875,048 (GRCm39) V309D probably damaging Het
Zfp53 T A 17: 21,729,772 (GRCm39) C602S probably benign Het
Zfp616 A T 11: 73,974,643 (GRCm39) N395I possibly damaging Het
Zfp644 T C 5: 106,783,867 (GRCm39) I862M probably benign Het
Zfp715 T C 7: 42,949,019 (GRCm39) T314A possibly damaging Het
Other mutations in Npas4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01537:Npas4 APN 19 5,037,355 (GRCm39) missense possibly damaging 0.93
IGL01865:Npas4 APN 19 5,035,819 (GRCm39) nonsense probably null
IGL02746:Npas4 APN 19 5,036,695 (GRCm39) missense probably damaging 0.99
IGL03061:Npas4 APN 19 5,036,365 (GRCm39) missense probably damaging 1.00
IGL03340:Npas4 APN 19 5,035,094 (GRCm39) utr 3 prime probably benign
R0879:Npas4 UTSW 19 5,036,944 (GRCm39) missense probably benign
R0920:Npas4 UTSW 19 5,036,344 (GRCm39) nonsense probably null
R1751:Npas4 UTSW 19 5,038,211 (GRCm39) missense probably benign 0.05
R1767:Npas4 UTSW 19 5,038,211 (GRCm39) missense probably benign 0.05
R2066:Npas4 UTSW 19 5,037,442 (GRCm39) missense probably damaging 0.99
R2201:Npas4 UTSW 19 5,037,392 (GRCm39) missense probably benign 0.06
R3973:Npas4 UTSW 19 5,036,579 (GRCm39) missense probably benign
R4117:Npas4 UTSW 19 5,037,391 (GRCm39) missense probably damaging 0.99
R4846:Npas4 UTSW 19 5,036,805 (GRCm39) missense probably benign 0.34
R6155:Npas4 UTSW 19 5,036,898 (GRCm39) missense probably damaging 1.00
R6255:Npas4 UTSW 19 5,036,403 (GRCm39) missense probably damaging 1.00
R6488:Npas4 UTSW 19 5,036,011 (GRCm39) missense probably damaging 1.00
R8427:Npas4 UTSW 19 5,036,108 (GRCm39) missense probably benign
R8864:Npas4 UTSW 19 5,038,556 (GRCm39) missense probably damaging 1.00
R9449:Npas4 UTSW 19 5,038,492 (GRCm39) missense probably damaging 1.00
R9573:Npas4 UTSW 19 5,035,837 (GRCm39) missense probably benign 0.19
Z1177:Npas4 UTSW 19 5,036,270 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTAGCGCTCTATCTCACACAAATC -3'
(R):5'- GCAGTCATGTACCGATCCAC -3'

Sequencing Primer
(F):5'- AAATCCAGTGCTAGGACTATCG -3'
(R):5'- GTCATGTACCGATCCACCAAGGG -3'
Posted On 2016-06-06