Incidental Mutation 'R5008:Dspp'
ID390276
Institutional Source Beutler Lab
Gene Symbol Dspp
Ensembl Gene ENSMUSG00000053268
Gene Namedentin sialophosphoprotein
SynonymsDmp3, Dsp, Dpp
MMRRC Submission 042599-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5008 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location104170712-104180127 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 104175573 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 194 (H194L)
Ref Sequence ENSEMBL: ENSMUSP00000108391 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112771]
Predicted Effect possibly damaging
Transcript: ENSMUST00000112771
AA Change: H194L

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000108391
Gene: ENSMUSG00000053268
AA Change: H194L

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 52 67 N/A INTRINSIC
internal_repeat_1 82 245 2.01e-11 PROSPERO
low complexity region 247 268 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
internal_repeat_1 285 438 2.01e-11 PROSPERO
internal_repeat_2 286 369 2.15e-10 PROSPERO
internal_repeat_2 370 454 2.15e-10 PROSPERO
low complexity region 456 472 N/A INTRINSIC
low complexity region 481 944 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: This gene encodes a member of the small integrin-binding ligand N-linked glycoprotein (SIBLING) family of proteins. The encoded preproprotein is secreted by odontoblasts and proteolytically processed to generate two principal proteins of the dentin extracellular matrix of the tooth, dentin sialoprotein and dentin phosphoprotein. These two protein products may play distinct but related roles in dentin mineralization. Mice lacking the encoded protein exhibit hypomineralization defects in dentin, similar to human dentinogenesis imperfecta. [provided by RefSeq, Feb 2016]
PHENOTYPE: Aging mice homozygous for a reporter/null allele display tooth abnormalities, including enlarged pulp cavities, a widened predentin zone, dentin hypomineralization, pulp exposure, and occasional brittle incisors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik C G 7: 27,578,767 T242R probably damaging Het
2310057N15Rik A G 16: 88,773,775 Y126H probably damaging Het
Catsperg1 A T 7: 29,195,434 Y579* probably null Het
Chchd5 A T 2: 129,130,399 probably null Het
Chd1l T C 3: 97,583,908 N423D probably damaging Het
Cntnap1 G A 11: 101,188,741 W1268* probably null Het
Col2a1 G A 15: 97,979,669 A1011V probably benign Het
Cst11 A G 2: 148,770,405 I104T probably benign Het
Dctd C T 8: 48,137,414 probably benign Het
Dnah17 A G 11: 118,110,577 F847L probably benign Het
Dyx1c1 T C 9: 72,972,318 probably benign Het
Frmd5 C A 2: 121,548,860 R414L probably damaging Het
Galnt3 C A 2: 66,085,241 R592L probably benign Het
Gm13128 A G 4: 144,331,266 S148G probably benign Het
Gm38706 T A 6: 130,484,617 noncoding transcript Het
Gm38706 T A 6: 130,485,020 noncoding transcript Het
Hivep3 A G 4: 120,098,917 K1477E probably benign Het
Igsf3 C T 3: 101,450,917 T708M probably damaging Het
Ikzf4 T G 10: 128,641,250 E64A probably benign Het
Klhl28 C T 12: 64,957,227 E171K probably damaging Het
Krt83 T A 15: 101,491,224 I76F probably damaging Het
Lat2 A G 5: 134,603,137 V152A probably benign Het
Lrp12 C T 15: 39,878,456 D288N probably damaging Het
Mdp1 C T 14: 55,659,226 R126Q probably damaging Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Muc6 G A 7: 141,639,559 probably benign Het
Myh4 T A 11: 67,253,532 S1243T probably benign Het
Myo3b T A 2: 70,258,068 F892I probably damaging Het
Nckap5l T C 15: 99,425,850 N924S possibly damaging Het
Npnt C T 3: 132,906,457 C218Y probably damaging Het
Olfr434 T A 6: 43,217,057 I48N probably damaging Het
Olfr715b A T 7: 107,106,081 M260K probably damaging Het
Olfr8 T A 10: 78,956,071 F289I probably damaging Het
Pfkm G A 15: 98,122,689 C233Y probably benign Het
Pigq A G 17: 25,934,203 V338A probably benign Het
Pld4 A T 12: 112,768,050 N415I possibly damaging Het
Pmm1 A T 15: 81,957,894 probably null Het
Polg G T 7: 79,460,074 P394T probably damaging Het
Polq A T 16: 37,062,387 I1359L probably benign Het
Pros1 A G 16: 62,928,185 N674D possibly damaging Het
Psme4 T A 11: 30,856,896 probably benign Het
Rasa3 A T 8: 13,584,959 C453* probably null Het
Repin1 T C 6: 48,596,608 V101A probably damaging Het
Rnf186 A T 4: 138,967,229 M27L probably benign Het
Rpa1 A G 11: 75,313,299 probably null Het
Rph3a G T 5: 120,945,391 N605K probably damaging Het
Rps18 A T 17: 33,952,284 probably null Het
Scgn A G 13: 23,990,975 I20T probably damaging Het
Skint6 A T 4: 112,991,255 V652E possibly damaging Het
Slc23a2 T C 2: 132,101,494 H29R probably damaging Het
Slc34a3 C T 2: 25,230,842 V383I possibly damaging Het
Slc5a1 A G 5: 33,152,573 M382V possibly damaging Het
Slc5a3 T A 16: 92,077,281 S75R probably damaging Het
Stat5b G C 11: 100,802,483 H111D probably benign Het
Tanc2 G A 11: 105,625,060 M1I probably null Het
Tbcel C T 9: 42,416,123 G328E probably damaging Het
Tecta C A 9: 42,373,062 R909L possibly damaging Het
Tnip1 A T 11: 54,937,984 M119K probably benign Het
Wdr34 C A 2: 30,032,769 R322L probably benign Het
Zbbx A C 3: 75,151,448 S51A possibly damaging Het
Zc3h12c T C 9: 52,116,700 N454S probably benign Het
Zfp980 G A 4: 145,702,083 G461S probably benign Het
Other mutations in Dspp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Dspp APN 5 104176892 missense possibly damaging 0.95
IGL01096:Dspp APN 5 104175367 missense possibly damaging 0.92
IGL01317:Dspp APN 5 104174048 missense probably damaging 0.99
IGL02365:Dspp APN 5 104176061 missense probably damaging 1.00
IGL02387:Dspp APN 5 104175624 missense possibly damaging 0.82
IGL02406:Dspp APN 5 104177366 nonsense probably null
IGL02445:Dspp APN 5 104177097 missense probably damaging 0.99
IGL02481:Dspp APN 5 104175648 missense possibly damaging 0.94
IGL02536:Dspp APN 5 104175665 missense probably damaging 0.99
IGL02572:Dspp APN 5 104177069 missense probably damaging 0.99
IGL02677:Dspp APN 5 104175977 missense possibly damaging 0.78
IGL02709:Dspp APN 5 104177250 missense unknown
IGL02723:Dspp APN 5 104175175 missense probably benign 0.03
IGL02740:Dspp APN 5 104177238 nonsense probably null
IGL03274:Dspp APN 5 104174948 missense probably damaging 0.99
IGL03293:Dspp APN 5 104177561 missense unknown
FR4449:Dspp UTSW 5 104178388 small deletion probably benign
R0018:Dspp UTSW 5 104178230 missense unknown
R0125:Dspp UTSW 5 104178039 missense unknown
R0503:Dspp UTSW 5 104177256 missense unknown
R1709:Dspp UTSW 5 104175724 missense probably damaging 0.98
R1851:Dspp UTSW 5 104174085 critical splice donor site probably null
R2001:Dspp UTSW 5 104178559 missense unknown
R2002:Dspp UTSW 5 104178559 missense unknown
R2198:Dspp UTSW 5 104175701 missense probably benign 0.37
R2279:Dspp UTSW 5 104178384 missense unknown
R4026:Dspp UTSW 5 104177697 missense unknown
R4066:Dspp UTSW 5 104177194 missense unknown
R4632:Dspp UTSW 5 104177406 missense unknown
R4693:Dspp UTSW 5 104178062 missense unknown
R4841:Dspp UTSW 5 104177186 missense unknown
R4841:Dspp UTSW 5 104177187 missense unknown
R4917:Dspp UTSW 5 104177923 missense unknown
R5015:Dspp UTSW 5 104177060 missense possibly damaging 0.46
R5214:Dspp UTSW 5 104178498 missense unknown
R5359:Dspp UTSW 5 104175886 missense probably damaging 0.98
R5538:Dspp UTSW 5 104175230 nonsense probably null
R5703:Dspp UTSW 5 104177051 missense possibly damaging 0.82
R5887:Dspp UTSW 5 104175455 missense probably damaging 1.00
R5902:Dspp UTSW 5 104178111 missense unknown
R5992:Dspp UTSW 5 104178451 missense unknown
R6019:Dspp UTSW 5 104178039 missense unknown
R6191:Dspp UTSW 5 104177348 missense unknown
R6362:Dspp UTSW 5 104176034 missense probably benign 0.19
R6736:Dspp UTSW 5 104178175 missense unknown
R6805:Dspp UTSW 5 104175850 missense probably benign 0.03
R7064:Dspp UTSW 5 104176938 missense possibly damaging 0.73
R7178:Dspp UTSW 5 104174066 missense probably benign 0.02
R7243:Dspp UTSW 5 104178361 small deletion probably benign
R7390:Dspp UTSW 5 104175686 missense probably damaging 0.98
R7454:Dspp UTSW 5 104175610 missense probably benign 0.01
R7585:Dspp UTSW 5 104175525 missense possibly damaging 0.90
R7662:Dspp UTSW 5 104177870 missense unknown
R7739:Dspp UTSW 5 104178146 missense unknown
R7755:Dspp UTSW 5 104178361 small deletion probably benign
R7805:Dspp UTSW 5 104175393 missense probably damaging 0.99
R7869:Dspp UTSW 5 104175665 missense probably damaging 0.99
R7945:Dspp UTSW 5 104178361 small deletion probably benign
R7978:Dspp UTSW 5 104178361 small deletion probably benign
R8088:Dspp UTSW 5 104177256 missense unknown
R8254:Dspp UTSW 5 104175328 missense possibly damaging 0.94
R8257:Dspp UTSW 5 104177001 missense probably benign 0.01
R8439:Dspp UTSW 5 104177296 missense unknown
R8486:Dspp UTSW 5 104174017 start gained probably benign
RF007:Dspp UTSW 5 104178361 small deletion probably benign
RF044:Dspp UTSW 5 104178424 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- CATGATGGGGTACATGCGAG -3'
(R):5'- ACCAGAGCCTGTATCTTCATCC -3'

Sequencing Primer
(F):5'- GCAAATGGCATCAGGAGCC -3'
(R):5'- AGAGCCTGTATCTTCATCCTCCTC -3'
Posted On2016-06-06