Mutagenetix > Incidental Mutations

Incidental Mutation 'R5008:Dspp'

390276

Institutional Source

Beutler Lab

Gene Symbol

Dspp

Ensembl Gene

ENSMUSG00000053268

Gene Name

dentin sialophosphoprotein

Synonyms

Dmp3, Dsp, Dpp

MMRRC Submission

042599-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5008 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

104170712-104180127 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 104175573 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 194 (H194L)

Ref Sequence

ENSEMBL: ENSMUSP00000108391 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000112771]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000112771
AA Change: H194L

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000108391
Gene: ENSMUSG00000053268
AA Change: H194L

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
low complexity region	52	67	N/A	INTRINSIC
internal_repeat_1	82	245	2.01e-11	PROSPERO
low complexity region	247	268	N/A	INTRINSIC
low complexity region	271	282	N/A	INTRINSIC
internal_repeat_1	285	438	2.01e-11	PROSPERO
internal_repeat_2	286	369	2.15e-10	PROSPERO
internal_repeat_2	370	454	2.15e-10	PROSPERO
low complexity region	456	472	N/A	INTRINSIC
low complexity region	481	944	N/A	INTRINSIC

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.7%

Validation Efficiency

97% (73/75)

MGI Phenotype

FUNCTION: This gene encodes a member of the small integrin-binding ligand N-linked glycoprotein (SIBLING) family of proteins. The encoded preproprotein is secreted by odontoblasts and proteolytically processed to generate two principal proteins of the dentin extracellular matrix of the tooth, dentin sialoprotein and dentin phosphoprotein. These two protein products may play distinct but related roles in dentin mineralization. Mice lacking the encoded protein exhibit hypomineralization defects in dentin, similar to human dentinogenesis imperfecta. [provided by RefSeq, Feb 2016]
PHENOTYPE: Aging mice homozygous for a reporter/null allele display tooth abnormalities, including enlarged pulp cavities, a widened predentin zone, dentin hypomineralization, pulp exposure, and occasional brittle incisors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310022A10Rik	C	G	7: 27,578,767	T242R	probably damaging	Het
2310057N15Rik	A	G	16: 88,773,775	Y126H	probably damaging	Het
Catsperg1	A	T	7: 29,195,434	Y579*	probably null	Het
Chchd5	A	T	2: 129,130,399		probably null	Het
Chd1l	T	C	3: 97,583,908	N423D	probably damaging	Het
Cntnap1	G	A	11: 101,188,741	W1268*	probably null	Het
Col2a1	G	A	15: 97,979,669	A1011V	probably benign	Het
Cst11	A	G	2: 148,770,405	I104T	probably benign	Het
Dctd	C	T	8: 48,137,414		probably benign	Het
Dnah17	A	G	11: 118,110,577	F847L	probably benign	Het
Dyx1c1	T	C	9: 72,972,318		probably benign	Het
Frmd5	C	A	2: 121,548,860	R414L	probably damaging	Het
Galnt3	C	A	2: 66,085,241	R592L	probably benign	Het
Gm13128	A	G	4: 144,331,266	S148G	probably benign	Het
Gm38706	T	A	6: 130,484,617		noncoding transcript	Het
Gm38706	T	A	6: 130,485,020		noncoding transcript	Het
Hivep3	A	G	4: 120,098,917	K1477E	probably benign	Het
Igsf3	C	T	3: 101,450,917	T708M	probably damaging	Het
Ikzf4	T	G	10: 128,641,250	E64A	probably benign	Het
Klhl28	C	T	12: 64,957,227	E171K	probably damaging	Het
Krt83	T	A	15: 101,491,224	I76F	probably damaging	Het
Lat2	A	G	5: 134,603,137	V152A	probably benign	Het
Lrp12	C	T	15: 39,878,456	D288N	probably damaging	Het
Mdp1	C	T	14: 55,659,226	R126Q	probably damaging	Het
Msh2	C	A	17: 87,723,413	A906E	probably benign	Het
Muc6	G	A	7: 141,639,559		probably benign	Het
Myh4	T	A	11: 67,253,532	S1243T	probably benign	Het
Myo3b	T	A	2: 70,258,068	F892I	probably damaging	Het
Nckap5l	T	C	15: 99,425,850	N924S	possibly damaging	Het
Npnt	C	T	3: 132,906,457	C218Y	probably damaging	Het
Olfr434	T	A	6: 43,217,057	I48N	probably damaging	Het
Olfr715b	A	T	7: 107,106,081	M260K	probably damaging	Het
Olfr8	T	A	10: 78,956,071	F289I	probably damaging	Het
Pfkm	G	A	15: 98,122,689	C233Y	probably benign	Het
Pigq	A	G	17: 25,934,203	V338A	probably benign	Het
Pld4	A	T	12: 112,768,050	N415I	possibly damaging	Het
Pmm1	A	T	15: 81,957,894		probably null	Het
Polg	G	T	7: 79,460,074	P394T	probably damaging	Het
Polq	A	T	16: 37,062,387	I1359L	probably benign	Het
Pros1	A	G	16: 62,928,185	N674D	possibly damaging	Het
Psme4	T	A	11: 30,856,896		probably benign	Het
Rasa3	A	T	8: 13,584,959	C453*	probably null	Het
Repin1	T	C	6: 48,596,608	V101A	probably damaging	Het
Rnf186	A	T	4: 138,967,229	M27L	probably benign	Het
Rpa1	A	G	11: 75,313,299		probably null	Het
Rph3a	G	T	5: 120,945,391	N605K	probably damaging	Het
Rps18	A	T	17: 33,952,284		probably null	Het
Scgn	A	G	13: 23,990,975	I20T	probably damaging	Het
Skint6	A	T	4: 112,991,255	V652E	possibly damaging	Het
Slc23a2	T	C	2: 132,101,494	H29R	probably damaging	Het
Slc34a3	C	T	2: 25,230,842	V383I	possibly damaging	Het
Slc5a1	A	G	5: 33,152,573	M382V	possibly damaging	Het
Slc5a3	T	A	16: 92,077,281	S75R	probably damaging	Het
Stat5b	G	C	11: 100,802,483	H111D	probably benign	Het
Tanc2	G	A	11: 105,625,060	M1I	probably null	Het
Tbcel	C	T	9: 42,416,123	G328E	probably damaging	Het
Tecta	C	A	9: 42,373,062	R909L	possibly damaging	Het
Tnip1	A	T	11: 54,937,984	M119K	probably benign	Het
Wdr34	C	A	2: 30,032,769	R322L	probably benign	Het
Zbbx	A	C	3: 75,151,448	S51A	possibly damaging	Het
Zc3h12c	T	C	9: 52,116,700	N454S	probably benign	Het
Zfp980	G	A	4: 145,702,083	G461S	probably benign	Het

Other mutations in Dspp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00973:Dspp	APN	5	104176892	missense	possibly damaging	0.95
IGL01096:Dspp	APN	5	104175367	missense	possibly damaging	0.92
IGL01317:Dspp	APN	5	104174048	missense	probably damaging	0.99
IGL02365:Dspp	APN	5	104176061	missense	probably damaging	1.00
IGL02387:Dspp	APN	5	104175624	missense	possibly damaging	0.82
IGL02406:Dspp	APN	5	104177366	nonsense	probably null
IGL02445:Dspp	APN	5	104177097	missense	probably damaging	0.99
IGL02481:Dspp	APN	5	104175648	missense	possibly damaging	0.94
IGL02536:Dspp	APN	5	104175665	missense	probably damaging	0.99
IGL02572:Dspp	APN	5	104177069	missense	probably damaging	0.99
IGL02677:Dspp	APN	5	104175977	missense	possibly damaging	0.78
IGL02709:Dspp	APN	5	104177250	missense	unknown
IGL02723:Dspp	APN	5	104175175	missense	probably benign	0.03
IGL02740:Dspp	APN	5	104177238	nonsense	probably null
IGL03274:Dspp	APN	5	104174948	missense	probably damaging	0.99
IGL03293:Dspp	APN	5	104177561	missense	unknown
FR4449:Dspp	UTSW	5	104178388	small deletion	probably benign
R0018:Dspp	UTSW	5	104178230	missense	unknown
R0125:Dspp	UTSW	5	104178039	missense	unknown
R0503:Dspp	UTSW	5	104177256	missense	unknown
R1709:Dspp	UTSW	5	104175724	missense	probably damaging	0.98
R1851:Dspp	UTSW	5	104174085	critical splice donor site	probably null
R2001:Dspp	UTSW	5	104178559	missense	unknown
R2002:Dspp	UTSW	5	104178559	missense	unknown
R2198:Dspp	UTSW	5	104175701	missense	probably benign	0.37
R2279:Dspp	UTSW	5	104178384	missense	unknown
R4026:Dspp	UTSW	5	104177697	missense	unknown
R4066:Dspp	UTSW	5	104177194	missense	unknown
R4632:Dspp	UTSW	5	104177406	missense	unknown
R4693:Dspp	UTSW	5	104178062	missense	unknown
R4841:Dspp	UTSW	5	104177186	missense	unknown
R4841:Dspp	UTSW	5	104177187	missense	unknown
R4917:Dspp	UTSW	5	104177923	missense	unknown
R5015:Dspp	UTSW	5	104177060	missense	possibly damaging	0.46
R5214:Dspp	UTSW	5	104178498	missense	unknown
R5359:Dspp	UTSW	5	104175886	missense	probably damaging	0.98
R5538:Dspp	UTSW	5	104175230	nonsense	probably null
R5703:Dspp	UTSW	5	104177051	missense	possibly damaging	0.82
R5887:Dspp	UTSW	5	104175455	missense	probably damaging	1.00
R5902:Dspp	UTSW	5	104178111	missense	unknown
R5992:Dspp	UTSW	5	104178451	missense	unknown
R6019:Dspp	UTSW	5	104178039	missense	unknown
R6191:Dspp	UTSW	5	104177348	missense	unknown
R6362:Dspp	UTSW	5	104176034	missense	probably benign	0.19
R6736:Dspp	UTSW	5	104178175	missense	unknown
R6805:Dspp	UTSW	5	104175850	missense	probably benign	0.03
R7064:Dspp	UTSW	5	104176938	missense	possibly damaging	0.73
R7178:Dspp	UTSW	5	104174066	missense	probably benign	0.02
R7243:Dspp	UTSW	5	104178361	small deletion	probably benign
R7390:Dspp	UTSW	5	104175686	missense	probably damaging	0.98
R7454:Dspp	UTSW	5	104175610	missense	probably benign	0.01
R7585:Dspp	UTSW	5	104175525	missense	possibly damaging	0.90
R7662:Dspp	UTSW	5	104177870	missense	unknown
R7739:Dspp	UTSW	5	104178146	missense	unknown
R7755:Dspp	UTSW	5	104178361	small deletion	probably benign
R7805:Dspp	UTSW	5	104175393	missense	probably damaging	0.99
R7869:Dspp	UTSW	5	104175665	missense	probably damaging	0.99
R7945:Dspp	UTSW	5	104178361	small deletion	probably benign
R7978:Dspp	UTSW	5	104178361	small deletion	probably benign
R8088:Dspp	UTSW	5	104177256	missense	unknown
R8254:Dspp	UTSW	5	104175328	missense	possibly damaging	0.94
R8257:Dspp	UTSW	5	104177001	missense	probably benign	0.01
R8439:Dspp	UTSW	5	104177296	missense	unknown
R8486:Dspp	UTSW	5	104174017	start gained	probably benign
RF007:Dspp	UTSW	5	104178361	small deletion	probably benign
RF044:Dspp	UTSW	5	104178424	small insertion	probably benign

Predicted Primers

PCR Primer
(F):5'- CATGATGGGGTACATGCGAG -3'
(R):5'- ACCAGAGCCTGTATCTTCATCC -3'

Sequencing Primer
(F):5'- GCAAATGGCATCAGGAGCC -3'
(R):5'- AGAGCCTGTATCTTCATCCTCCTC -3'

Posted On

2016-06-06