Incidental Mutation 'R5008:Olfr434'
ID390279
Institutional Source Beutler Lab
Gene Symbol Olfr434
Ensembl Gene ENSMUSG00000059411
Gene Nameolfactory receptor 434
SynonymsGA_x6K02T2P3E9-4341246-4340281, MOR261-10
MMRRC Submission 042599-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R5008 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location43213021-43218113 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 43217057 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 48 (I48N)
Ref Sequence ENSEMBL: ENSMUSP00000149678 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076752] [ENSMUST00000216562]
Predicted Effect probably damaging
Transcript: ENSMUST00000076752
AA Change: I48N

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000076039
Gene: ENSMUSG00000059411
AA Change: I48N

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 7.7e-62 PFAM
Pfam:7tm_1 40 289 2.1e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204448
AA Change: I48N
SMART Domains Protein: ENSMUSP00000145171
Gene: ENSMUSG00000059411
AA Change: I48N

DomainStartEndE-ValueType
Pfam:7tm_4 30 156 1.2e-26 PFAM
Pfam:7TM_GPCR_Srsx 34 156 3.5e-6 PFAM
Pfam:7tm_1 40 156 7.5e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215485
Predicted Effect probably damaging
Transcript: ENSMUST00000216562
AA Change: I48N

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Meta Mutation Damage Score 0.6490 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik C G 7: 27,578,767 T242R probably damaging Het
2310057N15Rik A G 16: 88,773,775 Y126H probably damaging Het
Catsperg1 A T 7: 29,195,434 Y579* probably null Het
Chchd5 A T 2: 129,130,399 probably null Het
Chd1l T C 3: 97,583,908 N423D probably damaging Het
Cntnap1 G A 11: 101,188,741 W1268* probably null Het
Col2a1 G A 15: 97,979,669 A1011V probably benign Het
Cst11 A G 2: 148,770,405 I104T probably benign Het
Dctd C T 8: 48,137,414 probably benign Het
Dnah17 A G 11: 118,110,577 F847L probably benign Het
Dspp A T 5: 104,175,573 H194L possibly damaging Het
Dyx1c1 T C 9: 72,972,318 probably benign Het
Frmd5 C A 2: 121,548,860 R414L probably damaging Het
Galnt3 C A 2: 66,085,241 R592L probably benign Het
Gm13128 A G 4: 144,331,266 S148G probably benign Het
Gm38706 T A 6: 130,484,617 noncoding transcript Het
Gm38706 T A 6: 130,485,020 noncoding transcript Het
Hivep3 A G 4: 120,098,917 K1477E probably benign Het
Igsf3 C T 3: 101,450,917 T708M probably damaging Het
Ikzf4 T G 10: 128,641,250 E64A probably benign Het
Klhl28 C T 12: 64,957,227 E171K probably damaging Het
Krt83 T A 15: 101,491,224 I76F probably damaging Het
Lat2 A G 5: 134,603,137 V152A probably benign Het
Lrp12 C T 15: 39,878,456 D288N probably damaging Het
Mdp1 C T 14: 55,659,226 R126Q probably damaging Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Muc6 G A 7: 141,639,559 probably benign Het
Myh4 T A 11: 67,253,532 S1243T probably benign Het
Myo3b T A 2: 70,258,068 F892I probably damaging Het
Nckap5l T C 15: 99,425,850 N924S possibly damaging Het
Npnt C T 3: 132,906,457 C218Y probably damaging Het
Olfr715b A T 7: 107,106,081 M260K probably damaging Het
Olfr8 T A 10: 78,956,071 F289I probably damaging Het
Pfkm G A 15: 98,122,689 C233Y probably benign Het
Pigq A G 17: 25,934,203 V338A probably benign Het
Pld4 A T 12: 112,768,050 N415I possibly damaging Het
Pmm1 A T 15: 81,957,894 probably null Het
Polg G T 7: 79,460,074 P394T probably damaging Het
Polq A T 16: 37,062,387 I1359L probably benign Het
Pros1 A G 16: 62,928,185 N674D possibly damaging Het
Psme4 T A 11: 30,856,896 probably benign Het
Rasa3 A T 8: 13,584,959 C453* probably null Het
Repin1 T C 6: 48,596,608 V101A probably damaging Het
Rnf186 A T 4: 138,967,229 M27L probably benign Het
Rpa1 A G 11: 75,313,299 probably null Het
Rph3a G T 5: 120,945,391 N605K probably damaging Het
Rps18 A T 17: 33,952,284 probably null Het
Scgn A G 13: 23,990,975 I20T probably damaging Het
Skint6 A T 4: 112,991,255 V652E possibly damaging Het
Slc23a2 T C 2: 132,101,494 H29R probably damaging Het
Slc34a3 C T 2: 25,230,842 V383I possibly damaging Het
Slc5a1 A G 5: 33,152,573 M382V possibly damaging Het
Slc5a3 T A 16: 92,077,281 S75R probably damaging Het
Stat5b G C 11: 100,802,483 H111D probably benign Het
Tanc2 G A 11: 105,625,060 M1I probably null Het
Tbcel C T 9: 42,416,123 G328E probably damaging Het
Tecta C A 9: 42,373,062 R909L possibly damaging Het
Tnip1 A T 11: 54,937,984 M119K probably benign Het
Wdr34 C A 2: 30,032,769 R322L probably benign Het
Zbbx A C 3: 75,151,448 S51A possibly damaging Het
Zc3h12c T C 9: 52,116,700 N454S probably benign Het
Zfp980 G A 4: 145,702,083 G461S probably benign Het
Other mutations in Olfr434
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Olfr434 APN 6 43217848 missense probably benign 0.00
R0347:Olfr434 UTSW 6 43217362 missense probably benign
R1099:Olfr434 UTSW 6 43217624 missense probably damaging 1.00
R1147:Olfr434 UTSW 6 43217212 missense probably damaging 0.99
R1147:Olfr434 UTSW 6 43217212 missense probably damaging 0.99
R1353:Olfr434 UTSW 6 43217690 missense probably benign 0.41
R1570:Olfr434 UTSW 6 43217351 missense probably benign
R1720:Olfr434 UTSW 6 43217560 missense probably damaging 1.00
R2098:Olfr434 UTSW 6 43217503 missense probably benign 0.02
R4707:Olfr434 UTSW 6 43216949 missense probably benign 0.27
R4942:Olfr434 UTSW 6 43216994 missense probably damaging 1.00
R5084:Olfr434 UTSW 6 43217660 missense probably damaging 1.00
R6472:Olfr434 UTSW 6 43217359 missense probably benign
R7592:Olfr434 UTSW 6 43217245 missense probably damaging 1.00
R7756:Olfr434 UTSW 6 43217016 nonsense probably null
R7784:Olfr434 UTSW 6 43217388 missense possibly damaging 0.82
R8056:Olfr434 UTSW 6 43217044 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AATTGAGTCTCAGTTCTCTGCATC -3'
(R):5'- GCTACATACCGGTCATAGGAC -3'

Sequencing Primer
(F):5'- CTGCATCCTCTTTCATAGTAAAATGG -3'
(R):5'- CATTCAGTGTGGGCAAAAGCC -3'
Posted On2016-06-06