Incidental Mutation 'R5008:Zc3h12c'
ID390291
Institutional Source Beutler Lab
Gene Symbol Zc3h12c
Ensembl Gene ENSMUSG00000035164
Gene Namezinc finger CCCH type containing 12C
SynonymsC230027N18Rik
MMRRC Submission 042599-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5008 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location52111344-52168572 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 52116700 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 454 (N454S)
Ref Sequence ENSEMBL: ENSMUSP00000150821 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165519] [ENSMUST00000213645]
Predicted Effect probably benign
Transcript: ENSMUST00000165519
AA Change: N473S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127603
Gene: ENSMUSG00000035164
AA Change: N473S

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 53 65 N/A INTRINSIC
low complexity region 106 121 N/A INTRINSIC
Pfam:RNase_Zc3h12a 264 420 1.6e-67 PFAM
low complexity region 644 659 N/A INTRINSIC
low complexity region 746 758 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184156
Predicted Effect probably benign
Transcript: ENSMUST00000213645
AA Change: N454S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.0603 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 97% (73/75)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik C G 7: 27,578,767 T242R probably damaging Het
2310057N15Rik A G 16: 88,773,775 Y126H probably damaging Het
Catsperg1 A T 7: 29,195,434 Y579* probably null Het
Chchd5 A T 2: 129,130,399 probably null Het
Chd1l T C 3: 97,583,908 N423D probably damaging Het
Cntnap1 G A 11: 101,188,741 W1268* probably null Het
Col2a1 G A 15: 97,979,669 A1011V probably benign Het
Cst11 A G 2: 148,770,405 I104T probably benign Het
Dctd C T 8: 48,137,414 probably benign Het
Dnah17 A G 11: 118,110,577 F847L probably benign Het
Dspp A T 5: 104,175,573 H194L possibly damaging Het
Dyx1c1 T C 9: 72,972,318 probably benign Het
Frmd5 C A 2: 121,548,860 R414L probably damaging Het
Galnt3 C A 2: 66,085,241 R592L probably benign Het
Gm13128 A G 4: 144,331,266 S148G probably benign Het
Gm38706 T A 6: 130,484,617 noncoding transcript Het
Gm38706 T A 6: 130,485,020 noncoding transcript Het
Hivep3 A G 4: 120,098,917 K1477E probably benign Het
Igsf3 C T 3: 101,450,917 T708M probably damaging Het
Ikzf4 T G 10: 128,641,250 E64A probably benign Het
Klhl28 C T 12: 64,957,227 E171K probably damaging Het
Krt83 T A 15: 101,491,224 I76F probably damaging Het
Lat2 A G 5: 134,603,137 V152A probably benign Het
Lrp12 C T 15: 39,878,456 D288N probably damaging Het
Mdp1 C T 14: 55,659,226 R126Q probably damaging Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Muc6 G A 7: 141,639,559 probably benign Het
Myh4 T A 11: 67,253,532 S1243T probably benign Het
Myo3b T A 2: 70,258,068 F892I probably damaging Het
Nckap5l T C 15: 99,425,850 N924S possibly damaging Het
Npnt C T 3: 132,906,457 C218Y probably damaging Het
Olfr434 T A 6: 43,217,057 I48N probably damaging Het
Olfr715b A T 7: 107,106,081 M260K probably damaging Het
Olfr8 T A 10: 78,956,071 F289I probably damaging Het
Pfkm G A 15: 98,122,689 C233Y probably benign Het
Pigq A G 17: 25,934,203 V338A probably benign Het
Pld4 A T 12: 112,768,050 N415I possibly damaging Het
Pmm1 A T 15: 81,957,894 probably null Het
Polg G T 7: 79,460,074 P394T probably damaging Het
Polq A T 16: 37,062,387 I1359L probably benign Het
Pros1 A G 16: 62,928,185 N674D possibly damaging Het
Psme4 T A 11: 30,856,896 probably benign Het
Rasa3 A T 8: 13,584,959 C453* probably null Het
Repin1 T C 6: 48,596,608 V101A probably damaging Het
Rnf186 A T 4: 138,967,229 M27L probably benign Het
Rpa1 A G 11: 75,313,299 probably null Het
Rph3a G T 5: 120,945,391 N605K probably damaging Het
Rps18 A T 17: 33,952,284 probably null Het
Scgn A G 13: 23,990,975 I20T probably damaging Het
Skint6 A T 4: 112,991,255 V652E possibly damaging Het
Slc23a2 T C 2: 132,101,494 H29R probably damaging Het
Slc34a3 C T 2: 25,230,842 V383I possibly damaging Het
Slc5a1 A G 5: 33,152,573 M382V possibly damaging Het
Slc5a3 T A 16: 92,077,281 S75R probably damaging Het
Stat5b G C 11: 100,802,483 H111D probably benign Het
Tanc2 G A 11: 105,625,060 M1I probably null Het
Tbcel C T 9: 42,416,123 G328E probably damaging Het
Tecta C A 9: 42,373,062 R909L possibly damaging Het
Tnip1 A T 11: 54,937,984 M119K probably benign Het
Wdr34 C A 2: 30,032,769 R322L probably benign Het
Zbbx A C 3: 75,151,448 S51A possibly damaging Het
Zfp980 G A 4: 145,702,083 G461S probably benign Het
Other mutations in Zc3h12c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Zc3h12c APN 9 52116665 missense probably damaging 1.00
IGL01288:Zc3h12c APN 9 52117651 splice site probably benign
IGL01993:Zc3h12c APN 9 52116311 missense probably damaging 1.00
R0035:Zc3h12c UTSW 9 52143747 missense probably benign 0.04
R0035:Zc3h12c UTSW 9 52143747 missense probably benign 0.04
R0131:Zc3h12c UTSW 9 52126623 missense possibly damaging 0.87
R0240:Zc3h12c UTSW 9 52144083 missense possibly damaging 0.77
R0240:Zc3h12c UTSW 9 52144083 missense possibly damaging 0.77
R1762:Zc3h12c UTSW 9 52115781 missense probably benign 0.17
R2101:Zc3h12c UTSW 9 52116421 missense probably benign 0.01
R3052:Zc3h12c UTSW 9 52144056 missense possibly damaging 0.94
R3689:Zc3h12c UTSW 9 52115956 missense probably benign 0.00
R4163:Zc3h12c UTSW 9 52115699 missense probably damaging 1.00
R4230:Zc3h12c UTSW 9 52144428 critical splice acceptor site probably null
R4803:Zc3h12c UTSW 9 52116553 missense probably damaging 1.00
R5153:Zc3h12c UTSW 9 52126647 missense probably damaging 1.00
R5682:Zc3h12c UTSW 9 52126576 missense probably damaging 1.00
R5843:Zc3h12c UTSW 9 52116682 missense probably benign 0.01
R6613:Zc3h12c UTSW 9 52116112 missense possibly damaging 0.65
R7097:Zc3h12c UTSW 9 52115926 missense possibly damaging 0.77
R7460:Zc3h12c UTSW 9 52144102 missense probably benign 0.13
R7867:Zc3h12c UTSW 9 52143948 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGGCCGGGATACTAACTAAGG -3'
(R):5'- TGCCTTTGTTACACACGTTCAG -3'

Sequencing Primer
(F):5'- GGTACAGACCTGGTTTCCAAC -3'
(R):5'- TGTTACACACGTTCAGATAGCC -3'
Posted On2016-06-06