Incidental Mutation 'R5008:Ikzf4'
ID390294
Institutional Source Beutler Lab
Gene Symbol Ikzf4
Ensembl Gene ENSMUSG00000002578
Gene NameIKAROS family zinc finger 4
SynonymsEos, Zfpn1a4, A630026H08Rik
MMRRC Submission 042599-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5008 (G1)
Quality Score212
Status Validated
Chromosome10
Chromosomal Location128630843-128645991 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 128641250 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Alanine at position 64 (E64A)
Ref Sequence ENSEMBL: ENSMUSP00000152234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000133342] [ENSMUST00000221150] [ENSMUST00000222067] [ENSMUST00000223162]
Predicted Effect probably benign
Transcript: ENSMUST00000065334
AA Change: E117A

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000066991
Gene: ENSMUSG00000002578
AA Change: E117A

DomainStartEndE-ValueType
ZnF_C2H2 159 181 7.67e-2 SMART
ZnF_C2H2 187 209 1.72e-4 SMART
ZnF_C2H2 215 237 1.72e-4 SMART
ZnF_C2H2 248 271 1.18e-2 SMART
low complexity region 423 436 N/A INTRINSIC
low complexity region 475 484 N/A INTRINSIC
ZnF_C2H2 531 553 7.49e0 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000113478
Gene: ENSMUSG00000002578
AA Change: E64A

DomainStartEndE-ValueType
ZnF_C2H2 106 128 7.67e-2 SMART
ZnF_C2H2 134 156 1.72e-4 SMART
ZnF_C2H2 162 184 1.72e-4 SMART
ZnF_C2H2 195 218 1.18e-2 SMART
low complexity region 370 383 N/A INTRINSIC
low complexity region 422 431 N/A INTRINSIC
ZnF_C2H2 478 500 7.49e0 SMART
ZnF_C2H2 506 530 3.52e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133342
AA Change: E117A

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000114404
Gene: ENSMUSG00000002578
AA Change: E117A

DomainStartEndE-ValueType
ZnF_C2H2 159 181 7.67e-2 SMART
ZnF_C2H2 187 209 1.72e-4 SMART
ZnF_C2H2 215 237 1.72e-4 SMART
ZnF_C2H2 248 271 1.18e-2 SMART
low complexity region 423 436 N/A INTRINSIC
low complexity region 475 484 N/A INTRINSIC
ZnF_C2H2 531 553 7.49e0 SMART
ZnF_C2H2 559 583 3.52e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149762
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180875
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221022
Predicted Effect probably benign
Transcript: ENSMUST00000221150
AA Change: E117A

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000222067
AA Change: E64A

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222899
Predicted Effect probably benign
Transcript: ENSMUST00000222901
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223145
Predicted Effect probably benign
Transcript: ENSMUST00000223162
Meta Mutation Damage Score 0.0578 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the Ikaros (ZNFN1A1; MIM 603023) family of transcription factors, which includes Eos, are expressed in lymphocytes and are implicated in the control of lymphoid development.[supplied by OMIM, Jul 2002]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik C G 7: 27,578,767 T242R probably damaging Het
2310057N15Rik A G 16: 88,773,775 Y126H probably damaging Het
Catsperg1 A T 7: 29,195,434 Y579* probably null Het
Chchd5 A T 2: 129,130,399 probably null Het
Chd1l T C 3: 97,583,908 N423D probably damaging Het
Cntnap1 G A 11: 101,188,741 W1268* probably null Het
Col2a1 G A 15: 97,979,669 A1011V probably benign Het
Cst11 A G 2: 148,770,405 I104T probably benign Het
Dctd C T 8: 48,137,414 probably benign Het
Dnah17 A G 11: 118,110,577 F847L probably benign Het
Dspp A T 5: 104,175,573 H194L possibly damaging Het
Dyx1c1 T C 9: 72,972,318 probably benign Het
Frmd5 C A 2: 121,548,860 R414L probably damaging Het
Galnt3 C A 2: 66,085,241 R592L probably benign Het
Gm13128 A G 4: 144,331,266 S148G probably benign Het
Gm38706 T A 6: 130,484,617 noncoding transcript Het
Gm38706 T A 6: 130,485,020 noncoding transcript Het
Hivep3 A G 4: 120,098,917 K1477E probably benign Het
Igsf3 C T 3: 101,450,917 T708M probably damaging Het
Klhl28 C T 12: 64,957,227 E171K probably damaging Het
Krt83 T A 15: 101,491,224 I76F probably damaging Het
Lat2 A G 5: 134,603,137 V152A probably benign Het
Lrp12 C T 15: 39,878,456 D288N probably damaging Het
Mdp1 C T 14: 55,659,226 R126Q probably damaging Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Muc6 G A 7: 141,639,559 probably benign Het
Myh4 T A 11: 67,253,532 S1243T probably benign Het
Myo3b T A 2: 70,258,068 F892I probably damaging Het
Nckap5l T C 15: 99,425,850 N924S possibly damaging Het
Npnt C T 3: 132,906,457 C218Y probably damaging Het
Olfr434 T A 6: 43,217,057 I48N probably damaging Het
Olfr715b A T 7: 107,106,081 M260K probably damaging Het
Olfr8 T A 10: 78,956,071 F289I probably damaging Het
Pfkm G A 15: 98,122,689 C233Y probably benign Het
Pigq A G 17: 25,934,203 V338A probably benign Het
Pld4 A T 12: 112,768,050 N415I possibly damaging Het
Pmm1 A T 15: 81,957,894 probably null Het
Polg G T 7: 79,460,074 P394T probably damaging Het
Polq A T 16: 37,062,387 I1359L probably benign Het
Pros1 A G 16: 62,928,185 N674D possibly damaging Het
Psme4 T A 11: 30,856,896 probably benign Het
Rasa3 A T 8: 13,584,959 C453* probably null Het
Repin1 T C 6: 48,596,608 V101A probably damaging Het
Rnf186 A T 4: 138,967,229 M27L probably benign Het
Rpa1 A G 11: 75,313,299 probably null Het
Rph3a G T 5: 120,945,391 N605K probably damaging Het
Rps18 A T 17: 33,952,284 probably null Het
Scgn A G 13: 23,990,975 I20T probably damaging Het
Skint6 A T 4: 112,991,255 V652E possibly damaging Het
Slc23a2 T C 2: 132,101,494 H29R probably damaging Het
Slc34a3 C T 2: 25,230,842 V383I possibly damaging Het
Slc5a1 A G 5: 33,152,573 M382V possibly damaging Het
Slc5a3 T A 16: 92,077,281 S75R probably damaging Het
Stat5b G C 11: 100,802,483 H111D probably benign Het
Tanc2 G A 11: 105,625,060 M1I probably null Het
Tbcel C T 9: 42,416,123 G328E probably damaging Het
Tecta C A 9: 42,373,062 R909L possibly damaging Het
Tnip1 A T 11: 54,937,984 M119K probably benign Het
Wdr34 C A 2: 30,032,769 R322L probably benign Het
Zbbx A C 3: 75,151,448 S51A possibly damaging Het
Zc3h12c T C 9: 52,116,700 N454S probably benign Het
Zfp980 G A 4: 145,702,083 G461S probably benign Het
Other mutations in Ikzf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Ikzf4 APN 10 128634547 missense probably benign 0.00
IGL01649:Ikzf4 APN 10 128635820 missense probably damaging 1.00
IGL02261:Ikzf4 APN 10 128636722 missense possibly damaging 0.50
IGL02315:Ikzf4 APN 10 128634145 missense probably damaging 1.00
R0099:Ikzf4 UTSW 10 128634197 missense probably damaging 0.97
R0200:Ikzf4 UTSW 10 128634676 missense probably damaging 0.96
R0365:Ikzf4 UTSW 10 128634407 missense probably benign
R0376:Ikzf4 UTSW 10 128632756 missense probably benign
R0456:Ikzf4 UTSW 10 128635808 missense probably damaging 0.98
R0536:Ikzf4 UTSW 10 128641249 missense probably benign 0.09
R1731:Ikzf4 UTSW 10 128634532 missense probably benign 0.03
R2017:Ikzf4 UTSW 10 128634157 missense probably damaging 1.00
R4158:Ikzf4 UTSW 10 128643736 intron probably benign
R4160:Ikzf4 UTSW 10 128643736 intron probably benign
R4623:Ikzf4 UTSW 10 128641119 missense probably damaging 1.00
R4789:Ikzf4 UTSW 10 128632706 missense probably benign 0.00
R5432:Ikzf4 UTSW 10 128634178 missense probably damaging 1.00
R6091:Ikzf4 UTSW 10 128634673 missense probably benign 0.15
R6445:Ikzf4 UTSW 10 128636555 splice site probably null
R7204:Ikzf4 UTSW 10 128643890 missense possibly damaging 0.64
R7219:Ikzf4 UTSW 10 128634383 missense possibly damaging 0.64
R7239:Ikzf4 UTSW 10 128641244 missense probably damaging 1.00
R7485:Ikzf4 UTSW 10 128632582 missense unknown
R7710:Ikzf4 UTSW 10 128632741 missense possibly damaging 0.46
R7988:Ikzf4 UTSW 10 128634455 missense probably damaging 1.00
Z1176:Ikzf4 UTSW 10 128634230 missense possibly damaging 0.69
Z1177:Ikzf4 UTSW 10 128642640 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TTTACTCACCAGTGTGGCTGC -3'
(R):5'- AATAAACAGGCCGTTGTCCCTC -3'

Sequencing Primer
(F):5'- CGCTTGTGTACCATGAGCACATTG -3'
(R):5'- CCTGACACTTGTAAGCCTCAGTG -3'
Posted On2016-06-06