Incidental Mutation 'R5008:Psme4'
ID390295
Institutional Source Beutler Lab
Gene Symbol Psme4
Ensembl Gene ENSMUSG00000040850
Gene Nameproteasome (prosome, macropain) activator subunit 4
Synonyms
MMRRC Submission 042599-MU
Accession Numbers

Genbank: NM_134013

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5008 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location30771726-30880361 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 30856896 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000045460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041231] [ENSMUST00000129824]
Predicted Effect probably benign
Transcript: ENSMUST00000041231
SMART Domains Protein: ENSMUSP00000045460
Gene: ENSMUSG00000040850

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 122 133 N/A INTRINSIC
Pfam:BLM10_mid 330 828 8.8e-119 PFAM
SCOP:d1b3ua_ 1183 1716 3e-14 SMART
Pfam:DUF3437 1756 1843 5.3e-39 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000129824
AA Change: M107K
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 97% (73/75)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele show normal repair of DNA double-strand breaks but exhibit significantly reduced male fertility due to defects in spermatogenesis observed in both meiotic spermatocytes and postmeiotic haploid spermatids. [provided by MGI curators]
Allele List at MGI

All alleles(25) : Targeted, knock-out(1) Gene trapped(24)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik C G 7: 27,578,767 T242R probably damaging Het
2310057N15Rik A G 16: 88,773,775 Y126H probably damaging Het
Catsperg1 A T 7: 29,195,434 Y579* probably null Het
Chchd5 A T 2: 129,130,399 probably null Het
Chd1l T C 3: 97,583,908 N423D probably damaging Het
Cntnap1 G A 11: 101,188,741 W1268* probably null Het
Col2a1 G A 15: 97,979,669 A1011V probably benign Het
Cst11 A G 2: 148,770,405 I104T probably benign Het
Dctd C T 8: 48,137,414 probably benign Het
Dnah17 A G 11: 118,110,577 F847L probably benign Het
Dspp A T 5: 104,175,573 H194L possibly damaging Het
Dyx1c1 T C 9: 72,972,318 probably benign Het
Frmd5 C A 2: 121,548,860 R414L probably damaging Het
Galnt3 C A 2: 66,085,241 R592L probably benign Het
Gm13128 A G 4: 144,331,266 S148G probably benign Het
Gm38706 T A 6: 130,484,617 noncoding transcript Het
Gm38706 T A 6: 130,485,020 noncoding transcript Het
Hivep3 A G 4: 120,098,917 K1477E probably benign Het
Igsf3 C T 3: 101,450,917 T708M probably damaging Het
Ikzf4 T G 10: 128,641,250 E64A probably benign Het
Klhl28 C T 12: 64,957,227 E171K probably damaging Het
Krt83 T A 15: 101,491,224 I76F probably damaging Het
Lat2 A G 5: 134,603,137 V152A probably benign Het
Lrp12 C T 15: 39,878,456 D288N probably damaging Het
Mdp1 C T 14: 55,659,226 R126Q probably damaging Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Muc6 G A 7: 141,639,559 probably benign Het
Myh4 T A 11: 67,253,532 S1243T probably benign Het
Myo3b T A 2: 70,258,068 F892I probably damaging Het
Nckap5l T C 15: 99,425,850 N924S possibly damaging Het
Npnt C T 3: 132,906,457 C218Y probably damaging Het
Olfr434 T A 6: 43,217,057 I48N probably damaging Het
Olfr715b A T 7: 107,106,081 M260K probably damaging Het
Olfr8 T A 10: 78,956,071 F289I probably damaging Het
Pfkm G A 15: 98,122,689 C233Y probably benign Het
Pigq A G 17: 25,934,203 V338A probably benign Het
Pld4 A T 12: 112,768,050 N415I possibly damaging Het
Pmm1 A T 15: 81,957,894 probably null Het
Polg G T 7: 79,460,074 P394T probably damaging Het
Polq A T 16: 37,062,387 I1359L probably benign Het
Pros1 A G 16: 62,928,185 N674D possibly damaging Het
Rasa3 A T 8: 13,584,959 C453* probably null Het
Repin1 T C 6: 48,596,608 V101A probably damaging Het
Rnf186 A T 4: 138,967,229 M27L probably benign Het
Rpa1 A G 11: 75,313,299 probably null Het
Rph3a G T 5: 120,945,391 N605K probably damaging Het
Rps18 A T 17: 33,952,284 probably null Het
Scgn A G 13: 23,990,975 I20T probably damaging Het
Skint6 A T 4: 112,991,255 V652E possibly damaging Het
Slc23a2 T C 2: 132,101,494 H29R probably damaging Het
Slc34a3 C T 2: 25,230,842 V383I possibly damaging Het
Slc5a1 A G 5: 33,152,573 M382V possibly damaging Het
Slc5a3 T A 16: 92,077,281 S75R probably damaging Het
Stat5b G C 11: 100,802,483 H111D probably benign Het
Tanc2 G A 11: 105,625,060 M1I probably null Het
Tbcel C T 9: 42,416,123 G328E probably damaging Het
Tecta C A 9: 42,373,062 R909L possibly damaging Het
Tnip1 A T 11: 54,937,984 M119K probably benign Het
Wdr34 C A 2: 30,032,769 R322L probably benign Het
Zbbx A C 3: 75,151,448 S51A possibly damaging Het
Zc3h12c T C 9: 52,116,700 N454S probably benign Het
Zfp980 G A 4: 145,702,083 G461S probably benign Het
Other mutations in Psme4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Psme4 APN 11 30815710 critical splice donor site probably null
IGL00401:Psme4 APN 11 30821079 splice site probably benign
IGL00475:Psme4 APN 11 30845252 missense probably benign 0.14
IGL00576:Psme4 APN 11 30823145 missense possibly damaging 0.50
IGL00817:Psme4 APN 11 30820129 missense probably benign 0.01
IGL01525:Psme4 APN 11 30809936 splice site probably benign
IGL01862:Psme4 APN 11 30812038 nonsense probably null
IGL02310:Psme4 APN 11 30837484 missense probably benign 0.06
IGL02477:Psme4 APN 11 30842083 missense probably damaging 0.99
IGL02545:Psme4 APN 11 30841586 missense possibly damaging 0.81
IGL02608:Psme4 APN 11 30820944 missense probably benign 0.34
IGL02621:Psme4 APN 11 30848131 missense probably benign
IGL02822:Psme4 APN 11 30848204 unclassified probably benign
IGL02833:Psme4 APN 11 30850715 unclassified probably benign
IGL02964:Psme4 APN 11 30791095 nonsense probably null
IGL03273:Psme4 APN 11 30848130 missense probably damaging 1.00
IGL03348:Psme4 APN 11 30876796 missense probably damaging 1.00
IGL03382:Psme4 APN 11 30807788 missense possibly damaging 0.94
H2330:Psme4 UTSW 11 30851210 missense probably benign 0.17
PIT4378001:Psme4 UTSW 11 30821079 splice site probably benign
R0276:Psme4 UTSW 11 30811980 missense probably damaging 1.00
R0462:Psme4 UTSW 11 30848117 missense probably damaging 1.00
R0685:Psme4 UTSW 11 30878415 missense probably damaging 1.00
R0766:Psme4 UTSW 11 30807687 intron probably null
R0830:Psme4 UTSW 11 30807797 missense possibly damaging 0.53
R0940:Psme4 UTSW 11 30815264 missense possibly damaging 0.53
R1018:Psme4 UTSW 11 30804310 missense probably damaging 1.00
R1312:Psme4 UTSW 11 30807687 intron probably null
R1448:Psme4 UTSW 11 30852744 missense probably damaging 1.00
R1713:Psme4 UTSW 11 30806310 missense probably damaging 1.00
R1732:Psme4 UTSW 11 30848105 missense probably benign 0.03
R1813:Psme4 UTSW 11 30804353 missense probably benign 0.14
R1905:Psme4 UTSW 11 30810922 missense probably damaging 1.00
R1907:Psme4 UTSW 11 30810922 missense probably damaging 1.00
R1911:Psme4 UTSW 11 30815658 missense probably benign 0.02
R1956:Psme4 UTSW 11 30832424 missense probably damaging 0.99
R1974:Psme4 UTSW 11 30819011 missense probably benign 0.00
R1980:Psme4 UTSW 11 30832615 missense possibly damaging 0.84
R1986:Psme4 UTSW 11 30830352 missense probably benign 0.01
R2046:Psme4 UTSW 11 30817723 splice site probably benign
R2142:Psme4 UTSW 11 30820998 missense possibly damaging 0.89
R2698:Psme4 UTSW 11 30874282 critical splice donor site probably null
R2844:Psme4 UTSW 11 30845173 splice site probably benign
R3807:Psme4 UTSW 11 30856027 splice site probably null
R3876:Psme4 UTSW 11 30856068 missense probably damaging 0.99
R4420:Psme4 UTSW 11 30812028 missense possibly damaging 0.67
R4584:Psme4 UTSW 11 30834318 missense probably damaging 1.00
R4615:Psme4 UTSW 11 30834287 missense probably benign 0.02
R4714:Psme4 UTSW 11 30832573 missense probably benign 0.02
R5109:Psme4 UTSW 11 30791095 nonsense probably null
R5155:Psme4 UTSW 11 30876806 missense probably damaging 1.00
R5199:Psme4 UTSW 11 30853272 missense probably benign 0.00
R5205:Psme4 UTSW 11 30832666 intron probably benign
R5452:Psme4 UTSW 11 30791168 missense probably benign
R5491:Psme4 UTSW 11 30815246 missense possibly damaging 0.63
R5685:Psme4 UTSW 11 30809837 missense probably damaging 0.99
R5764:Psme4 UTSW 11 30772364 intron probably benign
R5853:Psme4 UTSW 11 30791234 critical splice donor site probably null
R5865:Psme4 UTSW 11 30791993 missense possibly damaging 0.95
R5903:Psme4 UTSW 11 30841589 missense probably benign 0.28
R5927:Psme4 UTSW 11 30804294 missense possibly damaging 0.82
R6004:Psme4 UTSW 11 30856896 intron probably benign
R6102:Psme4 UTSW 11 30865567 missense probably damaging 1.00
R6247:Psme4 UTSW 11 30853245 missense possibly damaging 0.60
R6527:Psme4 UTSW 11 30832175 missense probably benign
R6750:Psme4 UTSW 11 30853203 missense probably damaging 1.00
R6885:Psme4 UTSW 11 30834307 nonsense probably null
R6939:Psme4 UTSW 11 30837291 missense probably damaging 0.99
R6945:Psme4 UTSW 11 30837437 missense probably benign 0.06
R7029:Psme4 UTSW 11 30772474 intron probably benign
R7049:Psme4 UTSW 11 30813904 intron probably null
R7098:Psme4 UTSW 11 30850661 missense probably damaging 0.99
R7107:Psme4 UTSW 11 30848105 missense probably benign 0.03
R7223:Psme4 UTSW 11 30874226 missense probably benign 0.33
R7319:Psme4 UTSW 11 30807790 missense probably benign 0.00
R7375:Psme4 UTSW 11 30772700 intron probably null
R7410:Psme4 UTSW 11 30815279 nonsense probably null
R7469:Psme4 UTSW 11 30802837 missense probably benign 0.20
R7651:Psme4 UTSW 11 30837334 missense probably damaging 0.98
R7679:Psme4 UTSW 11 30878425 missense probably damaging 0.99
R7681:Psme4 UTSW 11 30791975 missense possibly damaging 0.63
R7822:Psme4 UTSW 11 30874245 missense probably benign
R8013:Psme4 UTSW 11 30804320 missense probably benign 0.06
V5088:Psme4 UTSW 11 30851210 missense probably benign 0.17
X0063:Psme4 UTSW 11 30832600 missense possibly damaging 0.66
Z1176:Psme4 UTSW 11 30843522 missense possibly damaging 0.87
Z1177:Psme4 UTSW 11 30806311 missense probably damaging 1.00
Z1177:Psme4 UTSW 11 30812138 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATTGAAAATATGTTGCAGATATGC -3'
(R):5'- CTACATAAAGAAAACTACAGGCGGGA -3'

Sequencing Primer
(F):5'- CCATTATCCTCATGGTAGGGAGC -3'
(R):5'- TGGCTCATGCCAGTAATC -3'
Posted On2016-06-06