Mutagenetix > Incidental Mutation

Incidental Mutation 'R5008:Psme4'

390295

Institutional Source

Beutler Lab

Gene Symbol

Psme4

Ensembl Gene

ENSMUSG00000040850

Gene Name

proteasome (prosome, macropain) activator subunit 4

Synonyms

MMRRC Submission

042599-MU

Accession Numbers

Genbank: NM_134013

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5008 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

30771726-30880361 bp(+) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

T to A at 30856896 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000045460 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041231] [ENSMUST00000129824]

AlphaFold

Q5SSW2

Predicted Effect

probably benign
Transcript: ENSMUST00000041231

SMART Domains

Protein: ENSMUSP00000045460
Gene: ENSMUSG00000040850

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC
low complexity region	122	133	N/A	INTRINSIC
Pfam:BLM10_mid	330	828	8.8e-119	PFAM
SCOP:d1b3ua_	1183	1716	3e-14	SMART
Pfam:DUF3437	1756	1843	5.3e-39	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000129824
AA Change: M107K

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.7%

Validation Efficiency

97% (73/75)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele show normal repair of DNA double-strand breaks but exhibit significantly reduced male fertility due to defects in spermatogenesis observed in both meiotic spermatocytes and postmeiotic haploid spermatids. [provided by MGI curators]

Allele List at MGI

All alleles(25) : Targeted, knock-out(1) Gene trapped(24)

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310022A10Rik	C	G	7: 27,578,767	T242R	probably damaging	Het
2310057N15Rik	A	G	16: 88,773,775	Y126H	probably damaging	Het
Catsperg1	A	T	7: 29,195,434	Y579*	probably null	Het
Chchd5	A	T	2: 129,130,399		probably null	Het
Chd1l	T	C	3: 97,583,908	N423D	probably damaging	Het
Cntnap1	G	A	11: 101,188,741	W1268*	probably null	Het
Col2a1	G	A	15: 97,979,669	A1011V	probably benign	Het
Cst11	A	G	2: 148,770,405	I104T	probably benign	Het
Dctd	C	T	8: 48,137,414		probably benign	Het
Dnah17	A	G	11: 118,110,577	F847L	probably benign	Het
Dspp	A	T	5: 104,175,573	H194L	possibly damaging	Het
Dyx1c1	T	C	9: 72,972,318		probably benign	Het
Frmd5	C	A	2: 121,548,860	R414L	probably damaging	Het
Galnt3	C	A	2: 66,085,241	R592L	probably benign	Het
Gm13128	A	G	4: 144,331,266	S148G	probably benign	Het
Gm38706	T	A	6: 130,484,617		noncoding transcript	Het
Gm38706	T	A	6: 130,485,020		noncoding transcript	Het
Hivep3	A	G	4: 120,098,917	K1477E	probably benign	Het
Igsf3	C	T	3: 101,450,917	T708M	probably damaging	Het
Ikzf4	T	G	10: 128,641,250	E64A	probably benign	Het
Klhl28	C	T	12: 64,957,227	E171K	probably damaging	Het
Krt83	T	A	15: 101,491,224	I76F	probably damaging	Het
Lat2	A	G	5: 134,603,137	V152A	probably benign	Het
Lrp12	C	T	15: 39,878,456	D288N	probably damaging	Het
Mdp1	C	T	14: 55,659,226	R126Q	probably damaging	Het
Msh2	C	A	17: 87,723,413	A906E	probably benign	Het
Muc6	G	A	7: 141,639,559		probably benign	Het
Myh4	T	A	11: 67,253,532	S1243T	probably benign	Het
Myo3b	T	A	2: 70,258,068	F892I	probably damaging	Het
Nckap5l	T	C	15: 99,425,850	N924S	possibly damaging	Het
Npnt	C	T	3: 132,906,457	C218Y	probably damaging	Het
Olfr434	T	A	6: 43,217,057	I48N	probably damaging	Het
Olfr715b	A	T	7: 107,106,081	M260K	probably damaging	Het
Olfr8	T	A	10: 78,956,071	F289I	probably damaging	Het
Pfkm	G	A	15: 98,122,689	C233Y	probably benign	Het
Pigq	A	G	17: 25,934,203	V338A	probably benign	Het
Pld4	A	T	12: 112,768,050	N415I	possibly damaging	Het
Pmm1	A	T	15: 81,957,894		probably null	Het
Polg	G	T	7: 79,460,074	P394T	probably damaging	Het
Polq	A	T	16: 37,062,387	I1359L	probably benign	Het
Pros1	A	G	16: 62,928,185	N674D	possibly damaging	Het
Rasa3	A	T	8: 13,584,959	C453*	probably null	Het
Repin1	T	C	6: 48,596,608	V101A	probably damaging	Het
Rnf186	A	T	4: 138,967,229	M27L	probably benign	Het
Rpa1	A	G	11: 75,313,299		probably null	Het
Rph3a	G	T	5: 120,945,391	N605K	probably damaging	Het
Rps18	A	T	17: 33,952,284		probably null	Het
Scgn	A	G	13: 23,990,975	I20T	probably damaging	Het
Skint6	A	T	4: 112,991,255	V652E	possibly damaging	Het
Slc23a2	T	C	2: 132,101,494	H29R	probably damaging	Het
Slc34a3	C	T	2: 25,230,842	V383I	possibly damaging	Het
Slc5a1	A	G	5: 33,152,573	M382V	possibly damaging	Het
Slc5a3	T	A	16: 92,077,281	S75R	probably damaging	Het
Stat5b	G	C	11: 100,802,483	H111D	probably benign	Het
Tanc2	G	A	11: 105,625,060	M1I	probably null	Het
Tbcel	C	T	9: 42,416,123	G328E	probably damaging	Het
Tecta	C	A	9: 42,373,062	R909L	possibly damaging	Het
Tnip1	A	T	11: 54,937,984	M119K	probably benign	Het
Wdr34	C	A	2: 30,032,769	R322L	probably benign	Het
Zbbx	A	C	3: 75,151,448	S51A	possibly damaging	Het
Zc3h12c	T	C	9: 52,116,700	N454S	probably benign	Het
Zfp980	G	A	4: 145,702,083	G461S	probably benign	Het

Other mutations in Psme4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00228:Psme4	APN	11	30815710	critical splice donor site	probably null
IGL00401:Psme4	APN	11	30821079	splice site	probably benign
IGL00475:Psme4	APN	11	30845252	missense	probably benign	0.14
IGL00576:Psme4	APN	11	30823145	missense	possibly damaging	0.50
IGL00817:Psme4	APN	11	30820129	missense	probably benign	0.01
IGL01525:Psme4	APN	11	30809936	splice site	probably benign
IGL01862:Psme4	APN	11	30812038	nonsense	probably null
IGL02310:Psme4	APN	11	30837484	missense	probably benign	0.06
IGL02477:Psme4	APN	11	30842083	missense	probably damaging	0.99
IGL02545:Psme4	APN	11	30841586	missense	possibly damaging	0.81
IGL02608:Psme4	APN	11	30820944	missense	probably benign	0.34
IGL02621:Psme4	APN	11	30848131	missense	probably benign
IGL02822:Psme4	APN	11	30848204	unclassified	probably benign
IGL02833:Psme4	APN	11	30850715	unclassified	probably benign
IGL02964:Psme4	APN	11	30791095	nonsense	probably null
IGL03273:Psme4	APN	11	30848130	missense	probably damaging	1.00
IGL03348:Psme4	APN	11	30876796	missense	probably damaging	1.00
IGL03382:Psme4	APN	11	30807788	missense	possibly damaging	0.94
H2330:Psme4	UTSW	11	30851210	missense	probably benign	0.17
PIT4378001:Psme4	UTSW	11	30821079	splice site	probably benign
R0276:Psme4	UTSW	11	30811980	missense	probably damaging	1.00
R0462:Psme4	UTSW	11	30848117	missense	probably damaging	1.00
R0685:Psme4	UTSW	11	30878415	missense	probably damaging	1.00
R0766:Psme4	UTSW	11	30807687	splice site	probably null
R0830:Psme4	UTSW	11	30807797	missense	possibly damaging	0.53
R0940:Psme4	UTSW	11	30815264	missense	possibly damaging	0.53
R1018:Psme4	UTSW	11	30804310	missense	probably damaging	1.00
R1312:Psme4	UTSW	11	30807687	splice site	probably null
R1448:Psme4	UTSW	11	30852744	missense	probably damaging	1.00
R1713:Psme4	UTSW	11	30806310	missense	probably damaging	1.00
R1732:Psme4	UTSW	11	30848105	missense	probably benign	0.03
R1813:Psme4	UTSW	11	30804353	missense	probably benign	0.14
R1905:Psme4	UTSW	11	30810922	missense	probably damaging	1.00
R1907:Psme4	UTSW	11	30810922	missense	probably damaging	1.00
R1911:Psme4	UTSW	11	30815658	missense	probably benign	0.02
R1956:Psme4	UTSW	11	30832424	missense	probably damaging	0.99
R1974:Psme4	UTSW	11	30819011	missense	probably benign	0.00
R1980:Psme4	UTSW	11	30832615	missense	possibly damaging	0.84
R1986:Psme4	UTSW	11	30830352	missense	probably benign	0.01
R2046:Psme4	UTSW	11	30817723	splice site	probably benign
R2142:Psme4	UTSW	11	30820998	missense	possibly damaging	0.89
R2698:Psme4	UTSW	11	30874282	critical splice donor site	probably null
R2844:Psme4	UTSW	11	30845173	splice site	probably benign
R3807:Psme4	UTSW	11	30856027	splice site	probably null
R3876:Psme4	UTSW	11	30856068	missense	probably damaging	0.99
R4420:Psme4	UTSW	11	30812028	missense	possibly damaging	0.67
R4584:Psme4	UTSW	11	30834318	missense	probably damaging	1.00
R4615:Psme4	UTSW	11	30834287	missense	probably benign	0.02
R4714:Psme4	UTSW	11	30832573	missense	probably benign	0.02
R5109:Psme4	UTSW	11	30791095	nonsense	probably null
R5155:Psme4	UTSW	11	30876806	missense	probably damaging	1.00
R5199:Psme4	UTSW	11	30853272	missense	probably benign	0.00
R5205:Psme4	UTSW	11	30832666	intron	probably benign
R5452:Psme4	UTSW	11	30791168	missense	probably benign
R5491:Psme4	UTSW	11	30815246	missense	possibly damaging	0.63
R5685:Psme4	UTSW	11	30809837	missense	probably damaging	0.99
R5764:Psme4	UTSW	11	30772364	intron	probably benign
R5853:Psme4	UTSW	11	30791234	critical splice donor site	probably null
R5865:Psme4	UTSW	11	30791993	missense	possibly damaging	0.95
R5903:Psme4	UTSW	11	30841589	missense	probably benign	0.28
R5927:Psme4	UTSW	11	30804294	missense	possibly damaging	0.82
R6004:Psme4	UTSW	11	30856896	intron	probably benign
R6102:Psme4	UTSW	11	30865567	missense	probably damaging	1.00
R6247:Psme4	UTSW	11	30853245	missense	possibly damaging	0.60
R6527:Psme4	UTSW	11	30832175	missense	probably benign
R6750:Psme4	UTSW	11	30853203	missense	probably damaging	1.00
R6885:Psme4	UTSW	11	30834307	nonsense	probably null
R6939:Psme4	UTSW	11	30837291	missense	probably damaging	0.99
R6945:Psme4	UTSW	11	30837437	missense	probably benign	0.06
R7029:Psme4	UTSW	11	30772474	intron	probably benign
R7049:Psme4	UTSW	11	30813904	splice site	probably null
R7098:Psme4	UTSW	11	30850661	missense	probably damaging	0.99
R7107:Psme4	UTSW	11	30848105	missense	probably benign	0.03
R7223:Psme4	UTSW	11	30874226	missense	probably benign	0.33
R7319:Psme4	UTSW	11	30807790	missense	probably benign	0.00
R7375:Psme4	UTSW	11	30772700	splice site	probably null
R7410:Psme4	UTSW	11	30815279	nonsense	probably null
R7469:Psme4	UTSW	11	30802837	missense	probably benign	0.20
R7651:Psme4	UTSW	11	30837334	missense	probably damaging	0.98
R7679:Psme4	UTSW	11	30878425	missense	probably damaging	0.99
R7681:Psme4	UTSW	11	30791975	missense	possibly damaging	0.63
R7822:Psme4	UTSW	11	30874245	missense	probably benign
R8013:Psme4	UTSW	11	30804320	missense	probably benign	0.06
R8130:Psme4	UTSW	11	30842026	missense	probably damaging	1.00
R8323:Psme4	UTSW	11	30843532	missense	probably damaging	0.99
R8330:Psme4	UTSW	11	30843583	missense	probably benign	0.00
R8363:Psme4	UTSW	11	30812139	missense	probably damaging	1.00
R8491:Psme4	UTSW	11	30772161	missense	possibly damaging	0.90
R8690:Psme4	UTSW	11	30837319	missense	probably benign	0.00
R8696:Psme4	UTSW	11	30809896	missense	probably damaging	0.99
R8743:Psme4	UTSW	11	30878467	missense	probably damaging	1.00
R8998:Psme4	UTSW	11	30838957	missense	possibly damaging	0.78
R9241:Psme4	UTSW	11	30865576	missense	probably damaging	1.00
R9657:Psme4	UTSW	11	30838980	missense	probably benign	0.00
R9736:Psme4	UTSW	11	30847411	missense	probably damaging	0.99
R9744:Psme4	UTSW	11	30815294	critical splice donor site	probably null
R9746:Psme4	UTSW	11	30876868	nonsense	probably null
V5088:Psme4	UTSW	11	30851210	missense	probably benign	0.17
X0063:Psme4	UTSW	11	30832600	missense	possibly damaging	0.66
Z1176:Psme4	UTSW	11	30843522	missense	possibly damaging	0.87
Z1177:Psme4	UTSW	11	30806311	missense	probably damaging	1.00
Z1177:Psme4	UTSW	11	30812138	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACATTGAAAATATGTTGCAGATATGC -3'
(R):5'- CTACATAAAGAAAACTACAGGCGGGA -3'

Sequencing Primer
(F):5'- CCATTATCCTCATGGTAGGGAGC -3'
(R):5'- TGGCTCATGCCAGTAATC -3'

Posted On

2016-06-06