Mutagenetix > Incidental Mutation

Incidental Mutation 'R5008:Polq'

390314

Institutional Source

Beutler Lab

Gene Symbol

Polq

Ensembl Gene

ENSMUSG00000034206

Gene Name

polymerase (DNA directed), theta

Synonyms

A430110D14Rik

MMRRC Submission

042599-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.413) question?

Stock #

R5008 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

37011786-37095417 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 37062387 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Leucine at position 1359 (I1359L)

Ref Sequence

ENSEMBL: ENSMUSP00000071396 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000054034] [ENSMUST00000071452] [ENSMUST00000182946] [ENSMUST00000183112]

AlphaFold

Q8CGS6

Predicted Effect

probably benign
Transcript: ENSMUST00000054034
AA Change: I1638L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000059757
Gene: ENSMUSG00000034206
AA Change: I1638L

Domain	Start	End	E-Value	Type
low complexity region	2	29	N/A	INTRINSIC
low complexity region	38	55	N/A	INTRINSIC
DEXDc	87	298	4.09e-18	SMART
HELICc	398	484	4.02e-17	SMART
Blast:DEXDc	485	550	2e-25	BLAST
low complexity region	609	626	N/A	INTRINSIC
PDB:2ZJA\|A	712	826	5e-9	PDB
low complexity region	845	852	N/A	INTRINSIC
low complexity region	898	911	N/A	INTRINSIC
low complexity region	1126	1149	N/A	INTRINSIC
low complexity region	1813	1822	N/A	INTRINSIC
POLAc	2265	2504	3.3e-101	SMART
low complexity region	2521	2531	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000071452
AA Change: I1359L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000071396
Gene: ENSMUSG00000034206
AA Change: I1359L

Domain	Start	End	E-Value	Type
low complexity region	2	29	N/A	INTRINSIC
low complexity region	38	55	N/A	INTRINSIC
Pfam:DEAD	92	216	5.9e-12	PFAM
low complexity region	330	347	N/A	INTRINSIC
PDB:2ZJA\|A	433	547	5e-9	PDB
low complexity region	566	573	N/A	INTRINSIC
low complexity region	619	632	N/A	INTRINSIC
low complexity region	847	870	N/A	INTRINSIC
low complexity region	1534	1543	N/A	INTRINSIC
POLAc	1986	2225	3.3e-101	SMART
low complexity region	2242	2252	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182622

Predicted Effect

probably benign
Transcript: ENSMUST00000182946

SMART Domains

Protein: ENSMUSP00000138685
Gene: ENSMUSG00000034206

Domain	Start	End	E-Value	Type
low complexity region	2	29	N/A	INTRINSIC
low complexity region	38	55	N/A	INTRINSIC
Pfam:DEAD	92	164	1.3e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000183112

SMART Domains

Protein: ENSMUSP00000138648
Gene: ENSMUSG00000034206

Domain	Start	End	E-Value	Type
low complexity region	2	29	N/A	INTRINSIC
low complexity region	38	55	N/A	INTRINSIC
Pfam:DEAD	92	164	1.3e-9	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.7%

Validation Efficiency

97% (73/75)

MGI Phenotype

PHENOTYPE: Animals carrying a homozygous mutation at this locus display elevated levels of chromosomal damage. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310022A10Rik	C	G	7: 27,578,767	T242R	probably damaging	Het
2310057N15Rik	A	G	16: 88,773,775	Y126H	probably damaging	Het
Catsperg1	A	T	7: 29,195,434	Y579*	probably null	Het
Chchd5	A	T	2: 129,130,399		probably null	Het
Chd1l	T	C	3: 97,583,908	N423D	probably damaging	Het
Cntnap1	G	A	11: 101,188,741	W1268*	probably null	Het
Col2a1	G	A	15: 97,979,669	A1011V	probably benign	Het
Cst11	A	G	2: 148,770,405	I104T	probably benign	Het
Dctd	C	T	8: 48,137,414		probably benign	Het
Dnah17	A	G	11: 118,110,577	F847L	probably benign	Het
Dspp	A	T	5: 104,175,573	H194L	possibly damaging	Het
Dyx1c1	T	C	9: 72,972,318		probably benign	Het
Frmd5	C	A	2: 121,548,860	R414L	probably damaging	Het
Galnt3	C	A	2: 66,085,241	R592L	probably benign	Het
Gm13128	A	G	4: 144,331,266	S148G	probably benign	Het
Gm38706	T	A	6: 130,484,617		noncoding transcript	Het
Gm38706	T	A	6: 130,485,020		noncoding transcript	Het
Hivep3	A	G	4: 120,098,917	K1477E	probably benign	Het
Igsf3	C	T	3: 101,450,917	T708M	probably damaging	Het
Ikzf4	T	G	10: 128,641,250	E64A	probably benign	Het
Klhl28	C	T	12: 64,957,227	E171K	probably damaging	Het
Krt83	T	A	15: 101,491,224	I76F	probably damaging	Het
Lat2	A	G	5: 134,603,137	V152A	probably benign	Het
Lrp12	C	T	15: 39,878,456	D288N	probably damaging	Het
Mdp1	C	T	14: 55,659,226	R126Q	probably damaging	Het
Msh2	C	A	17: 87,723,413	A906E	probably benign	Het
Muc6	G	A	7: 141,639,559		probably benign	Het
Myh4	T	A	11: 67,253,532	S1243T	probably benign	Het
Myo3b	T	A	2: 70,258,068	F892I	probably damaging	Het
Nckap5l	T	C	15: 99,425,850	N924S	possibly damaging	Het
Npnt	C	T	3: 132,906,457	C218Y	probably damaging	Het
Olfr434	T	A	6: 43,217,057	I48N	probably damaging	Het
Olfr715b	A	T	7: 107,106,081	M260K	probably damaging	Het
Olfr8	T	A	10: 78,956,071	F289I	probably damaging	Het
Pfkm	G	A	15: 98,122,689	C233Y	probably benign	Het
Pigq	A	G	17: 25,934,203	V338A	probably benign	Het
Pld4	A	T	12: 112,768,050	N415I	possibly damaging	Het
Pmm1	A	T	15: 81,957,894		probably null	Het
Polg	G	T	7: 79,460,074	P394T	probably damaging	Het
Pros1	A	G	16: 62,928,185	N674D	possibly damaging	Het
Psme4	T	A	11: 30,856,896		probably benign	Het
Rasa3	A	T	8: 13,584,959	C453*	probably null	Het
Repin1	T	C	6: 48,596,608	V101A	probably damaging	Het
Rnf186	A	T	4: 138,967,229	M27L	probably benign	Het
Rpa1	A	G	11: 75,313,299		probably null	Het
Rph3a	G	T	5: 120,945,391	N605K	probably damaging	Het
Rps18	A	T	17: 33,952,284		probably null	Het
Scgn	A	G	13: 23,990,975	I20T	probably damaging	Het
Skint6	A	T	4: 112,991,255	V652E	possibly damaging	Het
Slc23a2	T	C	2: 132,101,494	H29R	probably damaging	Het
Slc34a3	C	T	2: 25,230,842	V383I	possibly damaging	Het
Slc5a1	A	G	5: 33,152,573	M382V	possibly damaging	Het
Slc5a3	T	A	16: 92,077,281	S75R	probably damaging	Het
Stat5b	G	C	11: 100,802,483	H111D	probably benign	Het
Tanc2	G	A	11: 105,625,060	M1I	probably null	Het
Tbcel	C	T	9: 42,416,123	G328E	probably damaging	Het
Tecta	C	A	9: 42,373,062	R909L	possibly damaging	Het
Tnip1	A	T	11: 54,937,984	M119K	probably benign	Het
Wdr34	C	A	2: 30,032,769	R322L	probably benign	Het
Zbbx	A	C	3: 75,151,448	S51A	possibly damaging	Het
Zc3h12c	T	C	9: 52,116,700	N454S	probably benign	Het
Zfp980	G	A	4: 145,702,083	G461S	probably benign	Het

Other mutations in Polq

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Polq	APN	16	37065247	splice site	probably benign
IGL00539:Polq	APN	16	37060569	missense	probably damaging	0.98
IGL00960:Polq	APN	16	37060512	missense	probably damaging	0.96
IGL01100:Polq	APN	16	37061112	missense	probably benign
IGL01112:Polq	APN	16	37017309	missense	probably damaging	1.00
IGL01138:Polq	APN	16	37045869	missense	possibly damaging	0.94
IGL01432:Polq	APN	16	37071822	splice site	probably benign
IGL01522:Polq	APN	16	37027903	missense	probably damaging	1.00
IGL01565:Polq	APN	16	37013113	missense	probably benign	0.00
IGL01592:Polq	APN	16	37034850	missense	probably benign	0.01
IGL01690:Polq	APN	16	37062838	missense	probably damaging	0.97
IGL01943:Polq	APN	16	37061443	missense	possibly damaging	0.47
IGL02531:Polq	APN	16	37062374	missense	possibly damaging	0.75
IGL02553:Polq	APN	16	37041768	missense	probably damaging	1.00
IGL02623:Polq	APN	16	37060375	missense	probably benign	0.04
IGL02692:Polq	APN	16	37060627	missense	probably damaging	1.00
IGL02717:Polq	APN	16	37022740	missense	probably damaging	1.00
IGL02937:Polq	APN	16	37013109	missense	probably benign	0.14
IGL02959:Polq	APN	16	37086566	missense	probably damaging	1.00
IGL03086:Polq	APN	16	37091049	missense	probably benign	0.02
IGL03141:Polq	APN	16	37017358	splice site	probably benign
IGL03302:Polq	APN	16	37071772	missense	probably damaging	1.00
IGL03393:Polq	APN	16	37044794	missense	probably damaging	1.00
R0013_Polq_667	UTSW	16	37061839	missense	possibly damaging	0.56
R4238_Polq_233	UTSW	16	37013181	missense	probably damaging	1.00
R4280_polq_867	UTSW	16	37082057	missense	probably damaging	1.00
G1Funyon:Polq	UTSW	16	37061819	missense	probably damaging	1.00
PIT4403001:Polq	UTSW	16	37060587	missense	probably benign	0.00
R0013:Polq	UTSW	16	37061839	missense	possibly damaging	0.56
R0082:Polq	UTSW	16	37017257	missense	probably benign	0.01
R0212:Polq	UTSW	16	37066854	missense	probably damaging	0.99
R0387:Polq	UTSW	16	37029430	missense	probably damaging	1.00
R0387:Polq	UTSW	16	37089317	missense	probably damaging	1.00
R0427:Polq	UTSW	16	37061993	nonsense	probably null
R0454:Polq	UTSW	16	37034890	missense	probably damaging	0.98
R0513:Polq	UTSW	16	37094502	missense	probably damaging	1.00
R0622:Polq	UTSW	16	37060993	missense	probably benign	0.02
R0848:Polq	UTSW	16	37062130	missense	probably benign	0.08
R1142:Polq	UTSW	16	37013217	missense	probably damaging	0.98
R1218:Polq	UTSW	16	37029446	missense	possibly damaging	0.93
R1331:Polq	UTSW	16	37041747	missense	probably damaging	1.00
R1398:Polq	UTSW	16	37062495	missense	possibly damaging	0.87
R1424:Polq	UTSW	16	37086528	missense	probably damaging	1.00
R1644:Polq	UTSW	16	37060264	missense	probably damaging	0.96
R1777:Polq	UTSW	16	37060224	missense	possibly damaging	0.94
R1820:Polq	UTSW	16	37029418	missense	possibly damaging	0.48
R1854:Polq	UTSW	16	37062109	missense	probably benign	0.01
R1880:Polq	UTSW	16	37086592	missense	possibly damaging	0.90
R1932:Polq	UTSW	16	37062304	missense	possibly damaging	0.92
R2008:Polq	UTSW	16	37062482	missense	probably damaging	0.96
R2014:Polq	UTSW	16	37078366	missense	probably damaging	1.00
R2026:Polq	UTSW	16	37062745	missense	possibly damaging	0.93
R2178:Polq	UTSW	16	37062829	missense	probably damaging	1.00
R2259:Polq	UTSW	16	37062097	missense	probably benign	0.03
R2266:Polq	UTSW	16	37062153	missense	possibly damaging	0.59
R2305:Polq	UTSW	16	37062337	missense	probably damaging	0.99
R2370:Polq	UTSW	16	37073939	missense	probably damaging	1.00
R2504:Polq	UTSW	16	37011942	missense	unknown
R2517:Polq	UTSW	16	37089325	missense	probably damaging	1.00
R2697:Polq	UTSW	16	37042153	missense	probably damaging	1.00
R2858:Polq	UTSW	16	37062753	missense	possibly damaging	0.88
R3436:Polq	UTSW	16	37062337	missense	probably damaging	0.99
R3437:Polq	UTSW	16	37062337	missense	probably damaging	0.99
R3699:Polq	UTSW	16	37042156	missense	probably damaging	1.00
R3838:Polq	UTSW	16	37078349	missense	probably damaging	1.00
R3875:Polq	UTSW	16	37074027	missense	probably damaging	0.99
R4050:Polq	UTSW	16	37092820	critical splice acceptor site	probably null
R4172:Polq	UTSW	16	37060758	missense	probably benign	0.02
R4238:Polq	UTSW	16	37013181	missense	probably damaging	1.00
R4240:Polq	UTSW	16	37013181	missense	probably damaging	1.00
R4280:Polq	UTSW	16	37082057	missense	probably damaging	1.00
R4296:Polq	UTSW	16	37061301	missense	possibly damaging	0.94
R4360:Polq	UTSW	16	37060339	missense	probably benign	0.00
R4373:Polq	UTSW	16	37013181	missense	probably damaging	1.00
R4375:Polq	UTSW	16	37013181	missense	probably damaging	1.00
R4376:Polq	UTSW	16	37013181	missense	probably damaging	1.00
R4509:Polq	UTSW	16	37048563	missense	probably damaging	1.00
R4510:Polq	UTSW	16	37048563	missense	probably damaging	1.00
R4511:Polq	UTSW	16	37048563	missense	probably damaging	1.00
R4543:Polq	UTSW	16	37060785	missense	probably benign	0.43
R4633:Polq	UTSW	16	37048542	missense	probably damaging	1.00
R4739:Polq	UTSW	16	37041747	missense	probably damaging	1.00
R4834:Polq	UTSW	16	37027814	missense	probably damaging	1.00
R4841:Polq	UTSW	16	37048783	critical splice donor site	probably null
R4842:Polq	UTSW	16	37048783	critical splice donor site	probably null
R4937:Polq	UTSW	16	37027912	missense	probably benign	0.01
R4955:Polq	UTSW	16	37061082	missense	probably benign	0.32
R4992:Polq	UTSW	16	37061162	missense	possibly damaging	0.59
R5221:Polq	UTSW	16	37042178	missense	probably damaging	0.98
R5254:Polq	UTSW	16	37089319	missense	probably damaging	1.00
R5292:Polq	UTSW	16	37061383	missense	probably damaging	1.00
R5375:Polq	UTSW	16	37082784	missense	probably damaging	1.00
R5480:Polq	UTSW	16	37013290	splice site	probably benign
R5552:Polq	UTSW	16	37094510	missense	possibly damaging	0.93
R5591:Polq	UTSW	16	37011885	utr 5 prime	probably benign
R5653:Polq	UTSW	16	37040534	missense	probably damaging	1.00
R5708:Polq	UTSW	16	37061018	missense	probably damaging	0.98
R5754:Polq	UTSW	16	37017263	missense	probably benign
R5757:Polq	UTSW	16	37086681	missense	probably benign	0.01
R5764:Polq	UTSW	16	37017344	missense	probably damaging	0.97
R6019:Polq	UTSW	16	37061764	missense	probably damaging	1.00
R6170:Polq	UTSW	16	37045812	missense	possibly damaging	0.82
R6177:Polq	UTSW	16	37071709	missense	probably damaging	0.98
R6307:Polq	UTSW	16	37017356	critical splice donor site	probably null
R6499:Polq	UTSW	16	37060827	missense	probably benign	0.03
R6520:Polq	UTSW	16	37060377	missense	possibly damaging	0.88
R6598:Polq	UTSW	16	37061631	missense	probably benign	0.39
R6694:Polq	UTSW	16	37015173	missense	probably null	0.99
R6788:Polq	UTSW	16	37077148	missense	probably damaging	1.00
R7104:Polq	UTSW	16	37089353	nonsense	probably null
R7159:Polq	UTSW	16	37062853	missense	possibly damaging	0.87
R7222:Polq	UTSW	16	37086633	nonsense	probably null
R7340:Polq	UTSW	16	37060926	missense	probably benign	0.00
R7361:Polq	UTSW	16	37060428	missense	probably benign	0.00
R7384:Polq	UTSW	16	37029418	missense	probably damaging	1.00
R7509:Polq	UTSW	16	37060343	missense	probably benign
R7509:Polq	UTSW	16	37060344	missense	probably benign	0.00
R7575:Polq	UTSW	16	37091134	missense	probably benign	0.00
R7785:Polq	UTSW	16	37027877	missense	probably damaging	1.00
R7787:Polq	UTSW	16	37017309	missense	probably damaging	1.00
R7891:Polq	UTSW	16	37027882	missense	probably damaging	1.00
R7898:Polq	UTSW	16	37044883	missense	probably damaging	0.98
R7917:Polq	UTSW	16	37065288	missense	probably benign	0.08
R7940:Polq	UTSW	16	37060642	missense	probably benign	0.27
R8028:Polq	UTSW	16	37061316	missense	possibly damaging	0.82
R8114:Polq	UTSW	16	37042215	missense	possibly damaging	0.94
R8144:Polq	UTSW	16	37029484	missense	probably benign	0.01
R8288:Polq	UTSW	16	37027910	missense	probably damaging	1.00
R8301:Polq	UTSW	16	37061819	missense	probably damaging	1.00
R8341:Polq	UTSW	16	37071771	missense	possibly damaging	0.96
R8348:Polq	UTSW	16	37017197	critical splice acceptor site	probably null
R8448:Polq	UTSW	16	37017197	critical splice acceptor site	probably null
R8815:Polq	UTSW	16	37033531	missense	probably damaging	1.00
R8843:Polq	UTSW	16	37011918	missense	unknown
R8878:Polq	UTSW	16	37040507	missense	probably benign	0.02
R9016:Polq	UTSW	16	37022797	missense	probably damaging	1.00
R9189:Polq	UTSW	16	37044903	missense	probably damaging	1.00
R9209:Polq	UTSW	16	37048649	missense	possibly damaging	0.94
R9352:Polq	UTSW	16	37041890	missense	probably damaging	0.98
R9398:Polq	UTSW	16	37061032	missense	probably benign	0.02
R9403:Polq	UTSW	16	37061853	missense	probably benign	0.00
R9489:Polq	UTSW	16	37022811	missense	probably benign	0.00
R9605:Polq	UTSW	16	37022811	missense	probably benign	0.00
R9664:Polq	UTSW	16	37027814	missense	probably damaging	0.98
R9801:Polq	UTSW	16	37092828	missense	probably damaging	1.00
X0060:Polq	UTSW	16	37017237	nonsense	probably null
Z1176:Polq	UTSW	16	37042257	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- AATGAAGGGTCCCCAAAGCC -3'
(R):5'- GGCTACCTTAGAAGCAGAAGC -3'

Sequencing Primer
(F):5'- GGGTCCCCAAAGCCCAAAC -3'
(R):5'- CTACCTTAGAAGCAGAAGCAGGAAC -3'

Posted On

2016-06-06