Incidental Mutation 'R5009:Tlr1'
ID390334
Institutional Source Beutler Lab
Gene Symbol Tlr1
Ensembl Gene ENSMUSG00000044827
Gene Nametoll-like receptor 1
Synonyms
MMRRC Submission 042600-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5009 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location64924679-64933563 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 64926224 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 337 (S337P)
Ref Sequence ENSEMBL: ENSMUSP00000142500 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059349] [ENSMUST00000197315]
Predicted Effect probably damaging
Transcript: ENSMUST00000059349
AA Change: S337P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000060793
Gene: ENSMUSG00000044827
AA Change: S337P

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
LRR 71 94 5.72e0 SMART
LRR 116 140 3.27e2 SMART
low complexity region 240 256 N/A INTRINSIC
LRR 374 397 9.75e0 SMART
LRR 400 423 4.98e1 SMART
low complexity region 427 438 N/A INTRINSIC
LRR 448 469 6.23e1 SMART
LRR 470 494 4.57e0 SMART
LRRCT 527 581 2.5e-11 SMART
transmembrane domain 583 605 N/A INTRINSIC
TIR 639 782 4.03e-41 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000197315
AA Change: S337P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142500
Gene: ENSMUSG00000044827
AA Change: S337P

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
LRR 71 94 5.72e0 SMART
Pfam:LRR_1 97 114 2.3e-2 PFAM
LRR 116 140 3.27e2 SMART
low complexity region 240 256 N/A INTRINSIC
LRR 374 397 9.75e0 SMART
LRR 400 423 4.98e1 SMART
low complexity region 427 438 N/A INTRINSIC
LRR 448 469 6.23e1 SMART
LRR 470 494 4.57e0 SMART
LRRCT 527 581 2.5e-11 SMART
transmembrane domain 583 605 N/A INTRINSIC
TIR 639 782 4.03e-41 SMART
Meta Mutation Damage Score 0.2271 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 100% (91/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This gene is ubiquitously expressed, and at higher levels than other TLR genes. Different length transcripts presumably resulting from use of alternative polyadenylation site, and/or from alternative splicing, have been noted for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display decreased macrophage peptoglycan-stimulated IL-6 production. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aim2 T C 1: 173,455,366 Y5H probably damaging Het
Atp7b A G 8: 22,027,698 S375P possibly damaging Het
BC106179 C A 16: 23,224,442 probably benign Het
Brinp3 T A 1: 146,901,049 N411K probably benign Het
Cacna1d A G 14: 30,079,332 V1386A probably damaging Het
Cuzd1 T A 7: 131,311,523 Y455F probably damaging Het
Dctd C T 8: 48,137,414 probably benign Het
Dip2b T A 15: 100,195,784 probably null Het
Dot1l G T 10: 80,771,196 R108L probably benign Het
Dysf T C 6: 84,151,986 S1413P probably damaging Het
Eea1 C A 10: 96,011,021 R388S probably benign Het
Elavl1 C T 8: 4,301,723 R131Q probably benign Het
Erich6b A G 14: 75,665,156 T138A possibly damaging Het
Esr1 C T 10: 4,712,394 T4I probably damaging Het
Ets1 T C 9: 32,732,999 S152P possibly damaging Het
Fam214a G A 9: 75,008,889 E257K probably damaging Het
Flrt2 T C 12: 95,779,773 V295A probably damaging Het
Fuk C T 8: 110,887,830 C609Y probably damaging Het
Gm13196 A G 2: 4,700,338 noncoding transcript Het
Gm1966 A G 7: 106,601,560 noncoding transcript Het
Gm5965 T A 16: 88,778,424 Y162N probably benign Het
Gm7853 A T 14: 36,089,509 noncoding transcript Het
Gm8126 C T 14: 43,261,608 A178V probably benign Het
Gpihbp1 A T 15: 75,597,721 probably benign Het
Greb1 T C 12: 16,724,857 T180A possibly damaging Het
Gsdme C T 6: 50,246,012 V108M possibly damaging Het
Gtpbp4 T C 13: 8,989,066 Y157C probably benign Het
Hivep1 T A 13: 42,158,753 F1490I probably benign Het
Il17ra T C 6: 120,482,207 V773A probably benign Het
Kctd8 T A 5: 69,110,733 T345S probably benign Het
Kdm3b T C 18: 34,824,710 S1243P probably benign Het
Klhdc1 T C 12: 69,251,938 V99A possibly damaging Het
Lars T G 18: 42,221,547 E778D probably benign Het
Map7 C T 10: 20,261,918 R279* probably null Het
Mdp1 C T 14: 55,659,226 R126Q probably damaging Het
Mtbp A G 15: 55,603,187 D532G probably benign Het
Mylk G A 16: 34,899,507 V597I probably benign Het
Necab1 A G 4: 14,947,503 probably benign Het
Nisch C T 14: 31,187,229 probably benign Het
Nlrp1a T C 11: 71,122,705 D573G probably benign Het
Noct C A 3: 51,248,061 N83K probably damaging Het
Olfr1349 A G 7: 6,514,547 L294P probably damaging Het
Olfr1368 T C 13: 21,142,265 N264S probably benign Het
Olfr362 C T 2: 37,105,455 R65H possibly damaging Het
Olfr446 C A 6: 42,927,433 D67E probably damaging Het
Olfr503 A G 7: 108,544,848 I106V probably benign Het
Olfr524 C T 7: 140,201,838 A311T probably benign Het
Olfr770 T C 10: 129,133,615 H51R probably benign Het
Osgepl1 T A 1: 53,318,180 V167D probably damaging Het
Pabpc6 T C 17: 9,668,560 E354G probably damaging Het
Pgghg A C 7: 140,943,390 D194A probably benign Het
Podnl1 A T 8: 84,126,258 H19L probably benign Het
Pold1 G T 7: 44,533,902 A977E probably benign Het
Poldip3 T C 15: 83,133,194 T227A probably damaging Het
Prss43 A G 9: 110,827,421 S59G possibly damaging Het
Ptpn14 T A 1: 189,850,534 I526N probably benign Het
Ptprb T C 10: 116,348,127 S1615P possibly damaging Het
Ptpro A G 6: 137,377,132 K169E probably damaging Het
Rab15 T C 12: 76,800,567 E114G probably damaging Het
Rcvrn A G 11: 67,695,724 E103G probably benign Het
Repin1 T A 6: 48,594,845 probably benign Het
Rita1 T A 5: 120,611,383 K88N probably damaging Het
Rtkn2 T C 10: 68,041,409 V433A probably benign Het
Runx1t1 T C 4: 13,865,231 I314T possibly damaging Het
Serpinb9c A C 13: 33,154,431 S190A probably benign Het
Shank2 C A 7: 144,070,179 H300Q probably benign Het
Slc4a4 A G 5: 89,149,298 probably null Het
Slc5a8 T C 10: 88,909,654 S375P probably benign Het
Spata5 T A 3: 37,433,277 probably benign Het
Spns3 C A 11: 72,537,201 W251L probably damaging Het
Spta1 A G 1: 174,240,223 N2072S possibly damaging Het
Sptbn1 A G 11: 30,124,016 V1351A probably benign Het
Sytl2 A T 7: 90,381,315 probably benign Het
Tax1bp1 A G 6: 52,729,493 probably benign Het
Tg A G 15: 66,696,586 D1374G probably benign Het
Trp63 A T 16: 25,868,227 D303V probably damaging Het
Ttn G A 2: 76,852,906 probably benign Het
Txndc5 T C 13: 38,528,184 probably null Het
Vmn2r77 T G 7: 86,801,807 D300E possibly damaging Het
Zfp729a A T 13: 67,620,246 N621K probably benign Het
Other mutations in Tlr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00571:Tlr1 APN 5 64926434 missense probably benign 0.01
IGL01324:Tlr1 APN 5 64925179 missense probably damaging 1.00
IGL01564:Tlr1 APN 5 64925846 missense probably damaging 1.00
IGL01663:Tlr1 APN 5 64925073 missense possibly damaging 0.48
IGL01689:Tlr1 APN 5 64925779 missense probably damaging 0.97
IGL01749:Tlr1 APN 5 64925947 nonsense probably null
IGL01751:Tlr1 APN 5 64925947 nonsense probably null
IGL01769:Tlr1 APN 5 64925947 nonsense probably null
IGL01899:Tlr1 APN 5 64927016 missense probably damaging 0.97
IGL02197:Tlr1 APN 5 64926454 missense probably damaging 1.00
IGL02295:Tlr1 APN 5 64925947 nonsense probably null
IGL02308:Tlr1 APN 5 64925947 nonsense probably null
IGL02309:Tlr1 APN 5 64925947 nonsense probably null
IGL02311:Tlr1 APN 5 64925947 nonsense probably null
IGL02591:Tlr1 APN 5 64926716 missense probably damaging 1.00
IGL02739:Tlr1 APN 5 64927126 missense probably benign 0.41
IGL03206:Tlr1 APN 5 64925057 missense probably damaging 0.99
IGL03055:Tlr1 UTSW 5 64926596 missense probably benign 0.05
R0315:Tlr1 UTSW 5 64926928 missense probably damaging 0.99
R0317:Tlr1 UTSW 5 64925967 nonsense probably null
R0511:Tlr1 UTSW 5 64926620 missense probably damaging 0.98
R1539:Tlr1 UTSW 5 64926976 missense probably damaging 1.00
R1552:Tlr1 UTSW 5 64926860 missense probably damaging 1.00
R1835:Tlr1 UTSW 5 64925700 missense probably benign 0.01
R1933:Tlr1 UTSW 5 64925438 missense possibly damaging 0.94
R1956:Tlr1 UTSW 5 64925177 missense probably damaging 1.00
R2099:Tlr1 UTSW 5 64925068 missense probably damaging 1.00
R2507:Tlr1 UTSW 5 64925296 missense probably damaging 1.00
R2508:Tlr1 UTSW 5 64925296 missense probably damaging 1.00
R2937:Tlr1 UTSW 5 64925908 missense probably damaging 0.96
R2938:Tlr1 UTSW 5 64925908 missense probably damaging 0.96
R3033:Tlr1 UTSW 5 64925569 missense probably damaging 1.00
R4164:Tlr1 UTSW 5 64927202 missense possibly damaging 0.47
R4226:Tlr1 UTSW 5 64925717 missense probably damaging 0.96
R4366:Tlr1 UTSW 5 64925837 missense probably benign 0.00
R5029:Tlr1 UTSW 5 64925681 missense probably damaging 0.97
R5069:Tlr1 UTSW 5 64926400 missense probably benign 0.01
R5186:Tlr1 UTSW 5 64925221 missense probably damaging 1.00
R5336:Tlr1 UTSW 5 64925802 missense probably damaging 1.00
R5500:Tlr1 UTSW 5 64927098 missense probably benign 0.08
R5503:Tlr1 UTSW 5 64926292 missense probably damaging 0.99
R5577:Tlr1 UTSW 5 64926085 missense possibly damaging 0.94
R6141:Tlr1 UTSW 5 64925213 missense possibly damaging 0.92
R6210:Tlr1 UTSW 5 64925286 missense probably damaging 1.00
R6238:Tlr1 UTSW 5 64927129 missense possibly damaging 0.86
R6284:Tlr1 UTSW 5 64927099 missense possibly damaging 0.93
R6311:Tlr1 UTSW 5 64926845 missense probably damaging 0.99
R7021:Tlr1 UTSW 5 64925713 missense possibly damaging 0.75
R7140:Tlr1 UTSW 5 64925678 missense probably benign 0.01
R7234:Tlr1 UTSW 5 64926724 missense probably damaging 0.96
R7278:Tlr1 UTSW 5 64926772 missense probably benign 0.03
R7378:Tlr1 UTSW 5 64925228 missense not run
R7652:Tlr1 UTSW 5 64926787 nonsense probably null
X0067:Tlr1 UTSW 5 64926575 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGTACCTTAGAGAATTCTGGC -3'
(R):5'- GCATACGCCAGTCAAATATTTCTC -3'

Sequencing Primer
(F):5'- ACCTTAGAGAATTCTGGCTAATGTC -3'
(R):5'- CAATTTCAAATGTGAAGCTACAAGG -3'
Posted On2016-06-06