Incidental Mutation 'R5009:Olfr1349'
ID390346
Institutional Source Beutler Lab
Gene Symbol Olfr1349
Ensembl Gene ENSMUSG00000048067
Gene Nameolfactory receptor 1349
SynonymsMOR232-8, GA_x6K02T2QGBW-3245761-3244808
MMRRC Submission 042600-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R5009 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location6513269-6522950 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 6514547 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 294 (L294P)
Ref Sequence ENSEMBL: ENSMUSP00000149880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051982] [ENSMUST00000207043] [ENSMUST00000207075] [ENSMUST00000207820] [ENSMUST00000213504] [ENSMUST00000213656] [ENSMUST00000216447]
Predicted Effect probably damaging
Transcript: ENSMUST00000051982
AA Change: L294P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000056639
Gene: ENSMUSG00000048067
AA Change: L294P

DomainStartEndE-ValueType
Pfam:7tm_4 40 317 1.9e-47 PFAM
Pfam:7tm_1 50 299 3.3e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122705
Predicted Effect probably benign
Transcript: ENSMUST00000207043
Predicted Effect probably benign
Transcript: ENSMUST00000207075
Predicted Effect probably damaging
Transcript: ENSMUST00000207820
AA Change: L294P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000213504
AA Change: L294P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000213656
AA Change: L294P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000216447
AA Change: L294P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 100% (91/91)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aim2 T C 1: 173,455,366 Y5H probably damaging Het
Atp7b A G 8: 22,027,698 S375P possibly damaging Het
BC106179 C A 16: 23,224,442 probably benign Het
Brinp3 T A 1: 146,901,049 N411K probably benign Het
Cacna1d A G 14: 30,079,332 V1386A probably damaging Het
Cuzd1 T A 7: 131,311,523 Y455F probably damaging Het
Dctd C T 8: 48,137,414 probably benign Het
Dip2b T A 15: 100,195,784 probably null Het
Dot1l G T 10: 80,771,196 R108L probably benign Het
Dysf T C 6: 84,151,986 S1413P probably damaging Het
Eea1 C A 10: 96,011,021 R388S probably benign Het
Elavl1 C T 8: 4,301,723 R131Q probably benign Het
Erich6b A G 14: 75,665,156 T138A possibly damaging Het
Esr1 C T 10: 4,712,394 T4I probably damaging Het
Ets1 T C 9: 32,732,999 S152P possibly damaging Het
Fam214a G A 9: 75,008,889 E257K probably damaging Het
Flrt2 T C 12: 95,779,773 V295A probably damaging Het
Fuk C T 8: 110,887,830 C609Y probably damaging Het
Gm13196 A G 2: 4,700,338 noncoding transcript Het
Gm1966 A G 7: 106,601,560 noncoding transcript Het
Gm5965 T A 16: 88,778,424 Y162N probably benign Het
Gm7853 A T 14: 36,089,509 noncoding transcript Het
Gm8126 C T 14: 43,261,608 A178V probably benign Het
Gpihbp1 A T 15: 75,597,721 probably benign Het
Greb1 T C 12: 16,724,857 T180A possibly damaging Het
Gsdme C T 6: 50,246,012 V108M possibly damaging Het
Gtpbp4 T C 13: 8,989,066 Y157C probably benign Het
Hivep1 T A 13: 42,158,753 F1490I probably benign Het
Il17ra T C 6: 120,482,207 V773A probably benign Het
Kctd8 T A 5: 69,110,733 T345S probably benign Het
Kdm3b T C 18: 34,824,710 S1243P probably benign Het
Klhdc1 T C 12: 69,251,938 V99A possibly damaging Het
Lars T G 18: 42,221,547 E778D probably benign Het
Map7 C T 10: 20,261,918 R279* probably null Het
Mdp1 C T 14: 55,659,226 R126Q probably damaging Het
Mtbp A G 15: 55,603,187 D532G probably benign Het
Mylk G A 16: 34,899,507 V597I probably benign Het
Necab1 A G 4: 14,947,503 probably benign Het
Nisch C T 14: 31,187,229 probably benign Het
Nlrp1a T C 11: 71,122,705 D573G probably benign Het
Noct C A 3: 51,248,061 N83K probably damaging Het
Olfr1368 T C 13: 21,142,265 N264S probably benign Het
Olfr362 C T 2: 37,105,455 R65H possibly damaging Het
Olfr446 C A 6: 42,927,433 D67E probably damaging Het
Olfr503 A G 7: 108,544,848 I106V probably benign Het
Olfr524 C T 7: 140,201,838 A311T probably benign Het
Olfr770 T C 10: 129,133,615 H51R probably benign Het
Osgepl1 T A 1: 53,318,180 V167D probably damaging Het
Pabpc6 T C 17: 9,668,560 E354G probably damaging Het
Pgghg A C 7: 140,943,390 D194A probably benign Het
Podnl1 A T 8: 84,126,258 H19L probably benign Het
Pold1 G T 7: 44,533,902 A977E probably benign Het
Poldip3 T C 15: 83,133,194 T227A probably damaging Het
Prss43 A G 9: 110,827,421 S59G possibly damaging Het
Ptpn14 T A 1: 189,850,534 I526N probably benign Het
Ptprb T C 10: 116,348,127 S1615P possibly damaging Het
Ptpro A G 6: 137,377,132 K169E probably damaging Het
Rab15 T C 12: 76,800,567 E114G probably damaging Het
Rcvrn A G 11: 67,695,724 E103G probably benign Het
Repin1 T A 6: 48,594,845 probably benign Het
Rita1 T A 5: 120,611,383 K88N probably damaging Het
Rtkn2 T C 10: 68,041,409 V433A probably benign Het
Runx1t1 T C 4: 13,865,231 I314T possibly damaging Het
Serpinb9c A C 13: 33,154,431 S190A probably benign Het
Shank2 C A 7: 144,070,179 H300Q probably benign Het
Slc4a4 A G 5: 89,149,298 probably null Het
Slc5a8 T C 10: 88,909,654 S375P probably benign Het
Spata5 T A 3: 37,433,277 probably benign Het
Spns3 C A 11: 72,537,201 W251L probably damaging Het
Spta1 A G 1: 174,240,223 N2072S possibly damaging Het
Sptbn1 A G 11: 30,124,016 V1351A probably benign Het
Sytl2 A T 7: 90,381,315 probably benign Het
Tax1bp1 A G 6: 52,729,493 probably benign Het
Tg A G 15: 66,696,586 D1374G probably benign Het
Tlr1 A G 5: 64,926,224 S337P probably damaging Het
Trp63 A T 16: 25,868,227 D303V probably damaging Het
Ttn G A 2: 76,852,906 probably benign Het
Txndc5 T C 13: 38,528,184 probably null Het
Vmn2r77 T G 7: 86,801,807 D300E possibly damaging Het
Zfp729a A T 13: 67,620,246 N621K probably benign Het
Other mutations in Olfr1349
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00917:Olfr1349 APN 7 6514578 missense probably damaging 1.00
IGL02350:Olfr1349 APN 7 6515226 missense probably damaging 1.00
IGL02357:Olfr1349 APN 7 6515226 missense probably damaging 1.00
IGL02955:Olfr1349 APN 7 6514683 missense probably damaging 1.00
R0593:Olfr1349 UTSW 7 6514809 missense probably benign 0.00
R2311:Olfr1349 UTSW 7 6514742 missense probably benign
R2396:Olfr1349 UTSW 7 6514785 missense probably damaging 0.98
R3699:Olfr1349 UTSW 7 6514994 missense probably damaging 0.99
R4095:Olfr1349 UTSW 7 6515253 missense possibly damaging 0.94
R6818:Olfr1349 UTSW 7 6514551 missense probably damaging 0.99
R7248:Olfr1349 UTSW 7 6514521 missense probably damaging 1.00
R7697:Olfr1349 UTSW 7 6514646 missense probably damaging 1.00
R7848:Olfr1349 UTSW 7 6514862 missense probably damaging 1.00
R7931:Olfr1349 UTSW 7 6514862 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCATGGGTTTCCTAGAAG -3'
(R):5'- ATGTGTTTGTGGCCACCGTC -3'

Sequencing Primer
(F):5'- TGGCATGGGTTTCCTAGAAGAAAGTC -3'
(R):5'- CTGTCCTTAGGATGCCATCGG -3'
Posted On2016-06-06