Incidental Mutation 'R5009:Cuzd1'
ID390352
Institutional Source Beutler Lab
Gene Symbol Cuzd1
Ensembl Gene ENSMUSG00000040205
Gene NameCUB and zona pellucida-like domains 1
SynonymsERG-1, UTCZP, UO-44, Itmap1
MMRRC Submission 042600-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R5009 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location131308554-131322292 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 131311523 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 455 (Y455F)
Ref Sequence ENSEMBL: ENSMUSP00000037168 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046611] [ENSMUST00000124096]
Predicted Effect probably damaging
Transcript: ENSMUST00000046611
AA Change: Y455F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037168
Gene: ENSMUSG00000040205
AA Change: Y455F

DomainStartEndE-ValueType
CUB 32 146 1.78e-16 SMART
CUB 154 265 1.1e-44 SMART
ZP 276 519 1.39e-63 SMART
transmembrane domain 571 593 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Meta Mutation Damage Score 0.6304 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 100% (91/91)
MGI Phenotype PHENOTYPE: Female mice homozygous for disruption of this gene exhibit impaired mammary gland development during puberty and during and following pregnancy and do not lactate. Homozygous mutant mice show an increased susceptibility to induced pancreatitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aim2 T C 1: 173,455,366 Y5H probably damaging Het
Atp7b A G 8: 22,027,698 S375P possibly damaging Het
BC106179 C A 16: 23,224,442 probably benign Het
Brinp3 T A 1: 146,901,049 N411K probably benign Het
Cacna1d A G 14: 30,079,332 V1386A probably damaging Het
Dctd C T 8: 48,137,414 probably benign Het
Dip2b T A 15: 100,195,784 probably null Het
Dot1l G T 10: 80,771,196 R108L probably benign Het
Dysf T C 6: 84,151,986 S1413P probably damaging Het
Eea1 C A 10: 96,011,021 R388S probably benign Het
Elavl1 C T 8: 4,301,723 R131Q probably benign Het
Erich6b A G 14: 75,665,156 T138A possibly damaging Het
Esr1 C T 10: 4,712,394 T4I probably damaging Het
Ets1 T C 9: 32,732,999 S152P possibly damaging Het
Fam214a G A 9: 75,008,889 E257K probably damaging Het
Flrt2 T C 12: 95,779,773 V295A probably damaging Het
Fuk C T 8: 110,887,830 C609Y probably damaging Het
Gm13196 A G 2: 4,700,338 noncoding transcript Het
Gm1966 A G 7: 106,601,560 noncoding transcript Het
Gm5965 T A 16: 88,778,424 Y162N probably benign Het
Gm7853 A T 14: 36,089,509 noncoding transcript Het
Gm8126 C T 14: 43,261,608 A178V probably benign Het
Gpihbp1 A T 15: 75,597,721 probably benign Het
Greb1 T C 12: 16,724,857 T180A possibly damaging Het
Gsdme C T 6: 50,246,012 V108M possibly damaging Het
Gtpbp4 T C 13: 8,989,066 Y157C probably benign Het
Hivep1 T A 13: 42,158,753 F1490I probably benign Het
Il17ra T C 6: 120,482,207 V773A probably benign Het
Kctd8 T A 5: 69,110,733 T345S probably benign Het
Kdm3b T C 18: 34,824,710 S1243P probably benign Het
Klhdc1 T C 12: 69,251,938 V99A possibly damaging Het
Lars T G 18: 42,221,547 E778D probably benign Het
Map7 C T 10: 20,261,918 R279* probably null Het
Mdp1 C T 14: 55,659,226 R126Q probably damaging Het
Mtbp A G 15: 55,603,187 D532G probably benign Het
Mylk G A 16: 34,899,507 V597I probably benign Het
Necab1 A G 4: 14,947,503 probably benign Het
Nisch C T 14: 31,187,229 probably benign Het
Nlrp1a T C 11: 71,122,705 D573G probably benign Het
Noct C A 3: 51,248,061 N83K probably damaging Het
Olfr1349 A G 7: 6,514,547 L294P probably damaging Het
Olfr1368 T C 13: 21,142,265 N264S probably benign Het
Olfr362 C T 2: 37,105,455 R65H possibly damaging Het
Olfr446 C A 6: 42,927,433 D67E probably damaging Het
Olfr503 A G 7: 108,544,848 I106V probably benign Het
Olfr524 C T 7: 140,201,838 A311T probably benign Het
Olfr770 T C 10: 129,133,615 H51R probably benign Het
Osgepl1 T A 1: 53,318,180 V167D probably damaging Het
Pabpc6 T C 17: 9,668,560 E354G probably damaging Het
Pgghg A C 7: 140,943,390 D194A probably benign Het
Podnl1 A T 8: 84,126,258 H19L probably benign Het
Pold1 G T 7: 44,533,902 A977E probably benign Het
Poldip3 T C 15: 83,133,194 T227A probably damaging Het
Prss43 A G 9: 110,827,421 S59G possibly damaging Het
Ptpn14 T A 1: 189,850,534 I526N probably benign Het
Ptprb T C 10: 116,348,127 S1615P possibly damaging Het
Ptpro A G 6: 137,377,132 K169E probably damaging Het
Rab15 T C 12: 76,800,567 E114G probably damaging Het
Rcvrn A G 11: 67,695,724 E103G probably benign Het
Repin1 T A 6: 48,594,845 probably benign Het
Rita1 T A 5: 120,611,383 K88N probably damaging Het
Rtkn2 T C 10: 68,041,409 V433A probably benign Het
Runx1t1 T C 4: 13,865,231 I314T possibly damaging Het
Serpinb9c A C 13: 33,154,431 S190A probably benign Het
Shank2 C A 7: 144,070,179 H300Q probably benign Het
Slc4a4 A G 5: 89,149,298 probably null Het
Slc5a8 T C 10: 88,909,654 S375P probably benign Het
Spata5 T A 3: 37,433,277 probably benign Het
Spns3 C A 11: 72,537,201 W251L probably damaging Het
Spta1 A G 1: 174,240,223 N2072S possibly damaging Het
Sptbn1 A G 11: 30,124,016 V1351A probably benign Het
Sytl2 A T 7: 90,381,315 probably benign Het
Tax1bp1 A G 6: 52,729,493 probably benign Het
Tg A G 15: 66,696,586 D1374G probably benign Het
Tlr1 A G 5: 64,926,224 S337P probably damaging Het
Trp63 A T 16: 25,868,227 D303V probably damaging Het
Ttn G A 2: 76,852,906 probably benign Het
Txndc5 T C 13: 38,528,184 probably null Het
Vmn2r77 T G 7: 86,801,807 D300E possibly damaging Het
Zfp729a A T 13: 67,620,246 N621K probably benign Het
Other mutations in Cuzd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Cuzd1 APN 7 131316136 missense probably damaging 0.99
IGL01140:Cuzd1 APN 7 131311794 missense probably damaging 1.00
IGL01773:Cuzd1 APN 7 131314885 missense probably damaging 1.00
IGL02960:Cuzd1 APN 7 131320103 missense probably benign 0.01
PIT4504001:Cuzd1 UTSW 7 131309800 missense possibly damaging 0.88
R0233:Cuzd1 UTSW 7 131311816 missense possibly damaging 0.61
R0233:Cuzd1 UTSW 7 131311816 missense possibly damaging 0.61
R0363:Cuzd1 UTSW 7 131316262 missense probably benign 0.16
R0375:Cuzd1 UTSW 7 131311908 intron probably benign
R0446:Cuzd1 UTSW 7 131316280 splice site probably null
R0482:Cuzd1 UTSW 7 131309872 unclassified probably benign
R0765:Cuzd1 UTSW 7 131316095 missense probably benign 0.40
R0932:Cuzd1 UTSW 7 131320194 intron probably benign
R1463:Cuzd1 UTSW 7 131316642 missense probably damaging 1.00
R1533:Cuzd1 UTSW 7 131311703 missense probably damaging 0.99
R1722:Cuzd1 UTSW 7 131311644 missense probably damaging 0.96
R1920:Cuzd1 UTSW 7 131309696 missense probably benign 0.00
R2027:Cuzd1 UTSW 7 131320091 missense possibly damaging 0.93
R2039:Cuzd1 UTSW 7 131309616 missense probably benign 0.00
R2039:Cuzd1 UTSW 7 131314914 intron probably benign
R2857:Cuzd1 UTSW 7 131316134 missense probably damaging 0.97
R2859:Cuzd1 UTSW 7 131316134 missense probably damaging 0.97
R4585:Cuzd1 UTSW 7 131314800 missense probably damaging 1.00
R4586:Cuzd1 UTSW 7 131314800 missense probably damaging 1.00
R4830:Cuzd1 UTSW 7 131318054 missense probably damaging 0.99
R4945:Cuzd1 UTSW 7 131316621 missense probably damaging 1.00
R5337:Cuzd1 UTSW 7 131316074 missense probably damaging 1.00
R5355:Cuzd1 UTSW 7 131316124 missense probably damaging 1.00
R6543:Cuzd1 UTSW 7 131309768 missense probably damaging 1.00
R6569:Cuzd1 UTSW 7 131311757 missense probably damaging 1.00
R6681:Cuzd1 UTSW 7 131311683 missense probably damaging 1.00
R6818:Cuzd1 UTSW 7 131316665 missense probably damaging 1.00
R6819:Cuzd1 UTSW 7 131309731 missense possibly damaging 0.51
R7031:Cuzd1 UTSW 7 131308851 missense probably benign 0.22
R7524:Cuzd1 UTSW 7 131311618 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGCCAATACACCAGTGCACATG -3'
(R):5'- TGGCTCTCTATGAGTCCGAC -3'

Sequencing Primer
(F):5'- TACACCAGTGCACATGTGTAC -3'
(R):5'- GAGTCCGACTCATTTGAAAACCTCG -3'
Posted On2016-06-06