Incidental Mutation 'R5009:Greb1'
ID 390378
Institutional Source Beutler Lab
Gene Symbol Greb1
Ensembl Gene ENSMUSG00000036523
Gene Name gene regulated by estrogen in breast cancer protein
Synonyms 5730583K22Rik
MMRRC Submission 042600-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5009 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 16670615-16800886 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 16724857 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 180 (T180A)
Ref Sequence ENSEMBL: ENSMUSP00000124348 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048064] [ENSMUST00000159120] [ENSMUST00000162112]
AlphaFold Q3UHK3
Predicted Effect possibly damaging
Transcript: ENSMUST00000048064
AA Change: T180A

PolyPhen 2 Score 0.786 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000044454
Gene: ENSMUSG00000036523
AA Change: T180A

DomainStartEndE-ValueType
Pfam:GREB1 1 1954 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000159120
AA Change: T180A

PolyPhen 2 Score 0.786 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000125339
Gene: ENSMUSG00000036523
AA Change: T180A

DomainStartEndE-ValueType
low complexity region 52 71 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 437 453 N/A INTRINSIC
low complexity region 480 503 N/A INTRINSIC
low complexity region 631 643 N/A INTRINSIC
low complexity region 1100 1118 N/A INTRINSIC
low complexity region 1196 1207 N/A INTRINSIC
low complexity region 1251 1265 N/A INTRINSIC
low complexity region 1596 1607 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159573
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161036
Predicted Effect possibly damaging
Transcript: ENSMUST00000162112
AA Change: T180A

PolyPhen 2 Score 0.786 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000124348
Gene: ENSMUSG00000036523
AA Change: T180A

DomainStartEndE-ValueType
low complexity region 52 71 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 437 453 N/A INTRINSIC
low complexity region 480 503 N/A INTRINSIC
low complexity region 631 643 N/A INTRINSIC
low complexity region 1128 1146 N/A INTRINSIC
low complexity region 1224 1235 N/A INTRINSIC
low complexity region 1279 1293 N/A INTRINSIC
low complexity region 1624 1635 N/A INTRINSIC
Meta Mutation Damage Score 0.0612 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 100% (91/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is an estrogen-responsive gene that is an early response gene in the estrogen receptor-regulated pathway. It is thought to play an important role in hormone-responsive tissues and cancer. Three alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aim2 T C 1: 173,455,366 Y5H probably damaging Het
Atp7b A G 8: 22,027,698 S375P possibly damaging Het
BC106179 C A 16: 23,224,442 probably benign Het
Brinp3 T A 1: 146,901,049 N411K probably benign Het
Cacna1d A G 14: 30,079,332 V1386A probably damaging Het
Cuzd1 T A 7: 131,311,523 Y455F probably damaging Het
Dctd C T 8: 48,137,414 probably benign Het
Dip2b T A 15: 100,195,784 probably null Het
Dot1l G T 10: 80,771,196 R108L probably benign Het
Dysf T C 6: 84,151,986 S1413P probably damaging Het
Eea1 C A 10: 96,011,021 R388S probably benign Het
Elavl1 C T 8: 4,301,723 R131Q probably benign Het
Erich6b A G 14: 75,665,156 T138A possibly damaging Het
Esr1 C T 10: 4,712,394 T4I probably damaging Het
Ets1 T C 9: 32,732,999 S152P possibly damaging Het
Fam214a G A 9: 75,008,889 E257K probably damaging Het
Flrt2 T C 12: 95,779,773 V295A probably damaging Het
Fuk C T 8: 110,887,830 C609Y probably damaging Het
Gm13196 A G 2: 4,700,338 noncoding transcript Het
Gm1966 A G 7: 106,601,560 noncoding transcript Het
Gm5965 T A 16: 88,778,424 Y162N probably benign Het
Gm7853 A T 14: 36,089,509 noncoding transcript Het
Gm8126 C T 14: 43,261,608 A178V probably benign Het
Gpihbp1 A T 15: 75,597,721 probably benign Het
Gsdme C T 6: 50,246,012 V108M possibly damaging Het
Gtpbp4 T C 13: 8,989,066 Y157C probably benign Het
Hivep1 T A 13: 42,158,753 F1490I probably benign Het
Il17ra T C 6: 120,482,207 V773A probably benign Het
Kctd8 T A 5: 69,110,733 T345S probably benign Het
Kdm3b T C 18: 34,824,710 S1243P probably benign Het
Klhdc1 T C 12: 69,251,938 V99A possibly damaging Het
Lars T G 18: 42,221,547 E778D probably benign Het
Map7 C T 10: 20,261,918 R279* probably null Het
Mdp1 C T 14: 55,659,226 R126Q probably damaging Het
Mtbp A G 15: 55,603,187 D532G probably benign Het
Mylk G A 16: 34,899,507 V597I probably benign Het
Necab1 A G 4: 14,947,503 probably benign Het
Nisch C T 14: 31,187,229 probably benign Het
Nlrp1a T C 11: 71,122,705 D573G probably benign Het
Noct C A 3: 51,248,061 N83K probably damaging Het
Olfr1349 A G 7: 6,514,547 L294P probably damaging Het
Olfr1368 T C 13: 21,142,265 N264S probably benign Het
Olfr362 C T 2: 37,105,455 R65H possibly damaging Het
Olfr446 C A 6: 42,927,433 D67E probably damaging Het
Olfr503 A G 7: 108,544,848 I106V probably benign Het
Olfr524 C T 7: 140,201,838 A311T probably benign Het
Olfr770 T C 10: 129,133,615 H51R probably benign Het
Osgepl1 T A 1: 53,318,180 V167D probably damaging Het
Pabpc6 T C 17: 9,668,560 E354G probably damaging Het
Pgghg A C 7: 140,943,390 D194A probably benign Het
Podnl1 A T 8: 84,126,258 H19L probably benign Het
Pold1 G T 7: 44,533,902 A977E probably benign Het
Poldip3 T C 15: 83,133,194 T227A probably damaging Het
Prss43 A G 9: 110,827,421 S59G possibly damaging Het
Ptpn14 T A 1: 189,850,534 I526N probably benign Het
Ptprb T C 10: 116,348,127 S1615P possibly damaging Het
Ptpro A G 6: 137,377,132 K169E probably damaging Het
Rab15 T C 12: 76,800,567 E114G probably damaging Het
Rcvrn A G 11: 67,695,724 E103G probably benign Het
Repin1 T A 6: 48,594,845 probably benign Het
Rita1 T A 5: 120,611,383 K88N probably damaging Het
Rtkn2 T C 10: 68,041,409 V433A probably benign Het
Runx1t1 T C 4: 13,865,231 I314T possibly damaging Het
Serpinb9c A C 13: 33,154,431 S190A probably benign Het
Shank2 C A 7: 144,070,179 H300Q probably benign Het
Slc4a4 A G 5: 89,149,298 probably null Het
Slc5a8 T C 10: 88,909,654 S375P probably benign Het
Spata5 T A 3: 37,433,277 probably benign Het
Spns3 C A 11: 72,537,201 W251L probably damaging Het
Spta1 A G 1: 174,240,223 N2072S possibly damaging Het
Sptbn1 A G 11: 30,124,016 V1351A probably benign Het
Sytl2 A T 7: 90,381,315 probably benign Het
Tax1bp1 A G 6: 52,729,493 probably benign Het
Tg A G 15: 66,696,586 D1374G probably benign Het
Tlr1 A G 5: 64,926,224 S337P probably damaging Het
Trp63 A T 16: 25,868,227 D303V probably damaging Het
Ttn G A 2: 76,852,906 probably benign Het
Txndc5 T C 13: 38,528,184 probably null Het
Vmn2r77 T G 7: 86,801,807 D300E possibly damaging Het
Zfp729a A T 13: 67,620,246 N621K probably benign Het
Other mutations in Greb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Greb1 APN 12 16711961 missense probably damaging 1.00
IGL01316:Greb1 APN 12 16698586 missense probably benign 0.04
IGL01464:Greb1 APN 12 16714826 missense probably damaging 0.99
IGL01474:Greb1 APN 12 16684501 missense probably benign
IGL01522:Greb1 APN 12 16701201 missense probably damaging 1.00
IGL01824:Greb1 APN 12 16711716 nonsense probably null
IGL01837:Greb1 APN 12 16684451 missense probably benign 0.19
IGL01991:Greb1 APN 12 16699681 missense probably damaging 1.00
IGL01996:Greb1 APN 12 16690845 missense possibly damaging 0.70
IGL02213:Greb1 APN 12 16706232 missense probably damaging 1.00
IGL02267:Greb1 APN 12 16717208 missense probably benign 0.00
IGL02512:Greb1 APN 12 16692712 missense possibly damaging 0.79
IGL02583:Greb1 APN 12 16706295 splice site probably benign
IGL02613:Greb1 APN 12 16739888 critical splice donor site probably null
IGL02648:Greb1 APN 12 16708682 missense probably damaging 1.00
IGL02679:Greb1 APN 12 16708723 missense probably damaging 1.00
begraben UTSW 12 16684373 missense possibly damaging 0.51
Eared UTSW 12 16673863 missense probably damaging 1.00
Humpback UTSW 12 16701171 missense probably damaging 1.00
pied_billed UTSW 12 16724857 missense possibly damaging 0.79
rednecked UTSW 12 16682152 missense probably damaging 0.99
G1patch:Greb1 UTSW 12 16688567 missense probably damaging 1.00
IGL03048:Greb1 UTSW 12 16733331 missense probably damaging 1.00
R0083:Greb1 UTSW 12 16696451 missense probably benign
R0100:Greb1 UTSW 12 16680224 missense probably benign 0.41
R0100:Greb1 UTSW 12 16680224 missense probably benign 0.41
R0220:Greb1 UTSW 12 16682286 missense probably damaging 1.00
R0245:Greb1 UTSW 12 16696456 missense probably damaging 1.00
R0540:Greb1 UTSW 12 16682193 missense probably damaging 1.00
R0547:Greb1 UTSW 12 16723411 missense probably benign
R0563:Greb1 UTSW 12 16680267 missense probably benign 0.23
R0607:Greb1 UTSW 12 16682193 missense probably damaging 1.00
R0610:Greb1 UTSW 12 16696442 missense probably benign
R0652:Greb1 UTSW 12 16696456 missense probably damaging 1.00
R0659:Greb1 UTSW 12 16680212 missense probably damaging 0.99
R0945:Greb1 UTSW 12 16673802 missense probably benign 0.31
R1055:Greb1 UTSW 12 16682251 missense probably damaging 0.98
R1445:Greb1 UTSW 12 16707851 missense probably damaging 1.00
R1471:Greb1 UTSW 12 16711774 missense probably damaging 0.97
R1503:Greb1 UTSW 12 16724819 nonsense probably null
R1566:Greb1 UTSW 12 16711828 missense possibly damaging 0.94
R1614:Greb1 UTSW 12 16701171 missense probably damaging 1.00
R1623:Greb1 UTSW 12 16674770 missense probably damaging 1.00
R1751:Greb1 UTSW 12 16723438 splice site probably benign
R1778:Greb1 UTSW 12 16690894 missense probably benign
R1842:Greb1 UTSW 12 16696243 missense probably damaging 1.00
R2040:Greb1 UTSW 12 16702650 missense probably damaging 1.00
R2153:Greb1 UTSW 12 16699532 missense probably damaging 1.00
R2178:Greb1 UTSW 12 16696387 missense probably damaging 1.00
R2194:Greb1 UTSW 12 16690908 missense probably benign 0.08
R2248:Greb1 UTSW 12 16680378 missense possibly damaging 0.90
R2474:Greb1 UTSW 12 16714953 missense possibly damaging 0.93
R2509:Greb1 UTSW 12 16724922 missense probably damaging 1.00
R2860:Greb1 UTSW 12 16711745 missense probably benign 0.28
R2861:Greb1 UTSW 12 16711745 missense probably benign 0.28
R2862:Greb1 UTSW 12 16711745 missense probably benign 0.28
R2866:Greb1 UTSW 12 16699550 missense probably damaging 1.00
R2890:Greb1 UTSW 12 16704478 missense probably damaging 1.00
R3056:Greb1 UTSW 12 16688591 missense probably damaging 0.96
R3863:Greb1 UTSW 12 16702420 missense probably damaging 1.00
R3864:Greb1 UTSW 12 16702420 missense probably damaging 1.00
R3956:Greb1 UTSW 12 16682299 missense probably damaging 1.00
R4493:Greb1 UTSW 12 16698610 missense probably benign 0.14
R4548:Greb1 UTSW 12 16699675 missense probably damaging 1.00
R4683:Greb1 UTSW 12 16711773 missense possibly damaging 0.75
R4739:Greb1 UTSW 12 16696328 missense probably damaging 1.00
R4770:Greb1 UTSW 12 16681356 missense probably benign 0.03
R4838:Greb1 UTSW 12 16684360 critical splice donor site probably null
R4925:Greb1 UTSW 12 16681471 missense probably damaging 1.00
R4982:Greb1 UTSW 12 16724761 missense probably damaging 0.98
R5086:Greb1 UTSW 12 16708022 intron probably benign
R5213:Greb1 UTSW 12 16714790 nonsense probably null
R5310:Greb1 UTSW 12 16716759 missense probably benign 0.09
R5353:Greb1 UTSW 12 16688566 nonsense probably null
R5544:Greb1 UTSW 12 16673796 missense probably damaging 1.00
R5605:Greb1 UTSW 12 16708726 missense probably damaging 0.96
R5708:Greb1 UTSW 12 16673842 missense probably benign 0.11
R5837:Greb1 UTSW 12 16688585 missense probably damaging 1.00
R5890:Greb1 UTSW 12 16733421 missense possibly damaging 0.90
R5938:Greb1 UTSW 12 16717258 missense probably damaging 1.00
R6049:Greb1 UTSW 12 16681394 missense probably damaging 0.99
R6093:Greb1 UTSW 12 16684486 missense probably benign
R6120:Greb1 UTSW 12 16708621 missense probably damaging 0.99
R6175:Greb1 UTSW 12 16674770 missense probably damaging 1.00
R6247:Greb1 UTSW 12 16716675 missense probably damaging 1.00
R6274:Greb1 UTSW 12 16735151 missense probably damaging 0.97
R6376:Greb1 UTSW 12 16699579 missense probably damaging 0.97
R6523:Greb1 UTSW 12 16684373 missense possibly damaging 0.51
R6557:Greb1 UTSW 12 16710383 missense probably benign 0.00
R6602:Greb1 UTSW 12 16709440 missense probably benign 0.44
R6621:Greb1 UTSW 12 16692717 missense probably damaging 1.00
R6645:Greb1 UTSW 12 16698579 missense probably benign 0.07
R6725:Greb1 UTSW 12 16688567 missense probably damaging 1.00
R6750:Greb1 UTSW 12 16688583 missense probably benign 0.05
R6863:Greb1 UTSW 12 16684420 missense probably damaging 1.00
R6914:Greb1 UTSW 12 16707902 missense probably damaging 0.97
R6996:Greb1 UTSW 12 16723354 missense probably benign 0.00
R7083:Greb1 UTSW 12 16723314 missense probably benign
R7147:Greb1 UTSW 12 16733427 missense probably damaging 1.00
R7238:Greb1 UTSW 12 16674672 missense probably damaging 0.99
R7290:Greb1 UTSW 12 16711738 missense probably damaging 1.00
R7358:Greb1 UTSW 12 16724881 missense probably damaging 1.00
R7395:Greb1 UTSW 12 16709430 critical splice donor site probably null
R7526:Greb1 UTSW 12 16716765 missense probably benign 0.00
R7530:Greb1 UTSW 12 16717206 missense probably benign 0.02
R7536:Greb1 UTSW 12 16682185 missense probably damaging 1.00
R7643:Greb1 UTSW 12 16711996 missense probably damaging 0.99
R7732:Greb1 UTSW 12 16673863 missense probably damaging 1.00
R7740:Greb1 UTSW 12 16740121 start gained probably benign
R7747:Greb1 UTSW 12 16674795 missense probably benign 0.01
R7760:Greb1 UTSW 12 16723416 missense probably benign
R7937:Greb1 UTSW 12 16716669 missense probably damaging 0.99
R8043:Greb1 UTSW 12 16711789 missense probably damaging 1.00
R8259:Greb1 UTSW 12 16724924 nonsense probably null
R8553:Greb1 UTSW 12 16723327 missense probably benign 0.00
R8559:Greb1 UTSW 12 16696435 missense probably damaging 1.00
R8690:Greb1 UTSW 12 16696547 missense probably benign 0.03
R8830:Greb1 UTSW 12 16688519 missense probably benign 0.35
R8911:Greb1 UTSW 12 16690902 missense possibly damaging 0.84
R8963:Greb1 UTSW 12 16724884 missense probably damaging 1.00
R8986:Greb1 UTSW 12 16684456 missense probably damaging 0.99
R9013:Greb1 UTSW 12 16739969 missense probably damaging 1.00
R9279:Greb1 UTSW 12 16682152 missense probably damaging 0.99
R9360:Greb1 UTSW 12 16740036 missense probably damaging 1.00
R9563:Greb1 UTSW 12 16724823 missense probably benign 0.06
R9616:Greb1 UTSW 12 16740037 missense probably damaging 1.00
R9627:Greb1 UTSW 12 16706166 missense probably damaging 1.00
R9731:Greb1 UTSW 12 16688597 missense probably damaging 1.00
R9761:Greb1 UTSW 12 16701274 missense probably benign 0.05
Z1176:Greb1 UTSW 12 16696756 missense probably benign 0.00
Z1177:Greb1 UTSW 12 16702491 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGTACAGAGATCCCACCC -3'
(R):5'- CTGATTACCAGGACAGGTTCTCTG -3'

Sequencing Primer
(F):5'- CTCCTAGCCTCACAATGCC -3'
(R):5'- CTCTGGCACTCTCTGGGTG -3'
Posted On 2016-06-06