Incidental Mutation 'R5009:Mylk'
ID 390399
Institutional Source Beutler Lab
Gene Symbol Mylk
Ensembl Gene ENSMUSG00000022836
Gene Name myosin, light polypeptide kinase
Synonyms Mlck, nmMlck, telokin, A930019C19Rik, 9530072E15Rik, MLCK108, MLCK210
MMRRC Submission 042600-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5009 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 34745210-35002420 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 34899507 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 597 (V597I)
Ref Sequence ENSEMBL: ENSMUSP00000023538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023538]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000023538
AA Change: V597I

PolyPhen 2 Score 0.393 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000023538
Gene: ENSMUSG00000022836
AA Change: V597I

DomainStartEndE-ValueType
IGc2 54 122 9.05e-11 SMART
IGc2 177 244 3.94e-11 SMART
Pfam:23ISL 255 409 3.6e-60 PFAM
IGc2 423 491 1.55e-9 SMART
IGc2 523 587 3.32e-18 SMART
IGc2 632 699 6.02e-7 SMART
IGc2 730 798 1.36e-5 SMART
low complexity region 827 844 N/A INTRINSIC
IGc2 1141 1208 2.42e-11 SMART
low complexity region 1251 1269 N/A INTRINSIC
IG 1275 1359 4.56e-7 SMART
FN3 1362 1444 2.33e-11 SMART
low complexity region 1457 1479 N/A INTRINSIC
S_TKc 1495 1750 4.23e-95 SMART
IGc2 1852 1920 5.92e-15 SMART
low complexity region 1934 1950 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232482
Meta Mutation Damage Score 0.0891 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 100% (91/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, a muscle member of the immunoglobulin gene superfamily, encodes myosin light chain kinase which is a calcium/calmodulin dependent enzyme. This kinase phosphorylates myosin regulatory light chains to facilitate myosin interaction with actin filaments to produce contractile activity. This gene encodes both smooth muscle and nonmuscle isoforms. In addition, using a separate promoter in an intron in the 3' region, it encodes telokin, a small protein identical in sequence to the C-terminus of myosin light chain kinase, that is independently expressed in smooth muscle and functions to stabilize unphosphorylated myosin filaments. A pseudogene is located on the p arm of chromosome 3. Four transcript variants that produce four isoforms of the calcium/calmodulin dependent enzyme have been identified as well as two transcripts that produce two isoforms of telokin. Additional variants have been identified but lack full length transcripts. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice that lack the isoform abundant in endothelial cells show a reduced susceptibility to acute lung injury. Mice lacking the smooth muscle isoform exhibit partial pre- or neonatal lethality, short small intestine and impaired smooth muscle contraction in the colon. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aim2 T C 1: 173,455,366 Y5H probably damaging Het
Atp7b A G 8: 22,027,698 S375P possibly damaging Het
BC106179 C A 16: 23,224,442 probably benign Het
Brinp3 T A 1: 146,901,049 N411K probably benign Het
Cacna1d A G 14: 30,079,332 V1386A probably damaging Het
Cuzd1 T A 7: 131,311,523 Y455F probably damaging Het
Dctd C T 8: 48,137,414 probably benign Het
Dip2b T A 15: 100,195,784 probably null Het
Dot1l G T 10: 80,771,196 R108L probably benign Het
Dysf T C 6: 84,151,986 S1413P probably damaging Het
Eea1 C A 10: 96,011,021 R388S probably benign Het
Elavl1 C T 8: 4,301,723 R131Q probably benign Het
Erich6b A G 14: 75,665,156 T138A possibly damaging Het
Esr1 C T 10: 4,712,394 T4I probably damaging Het
Ets1 T C 9: 32,732,999 S152P possibly damaging Het
Fam214a G A 9: 75,008,889 E257K probably damaging Het
Flrt2 T C 12: 95,779,773 V295A probably damaging Het
Fuk C T 8: 110,887,830 C609Y probably damaging Het
Gm13196 A G 2: 4,700,338 noncoding transcript Het
Gm1966 A G 7: 106,601,560 noncoding transcript Het
Gm5965 T A 16: 88,778,424 Y162N probably benign Het
Gm7853 A T 14: 36,089,509 noncoding transcript Het
Gm8126 C T 14: 43,261,608 A178V probably benign Het
Gpihbp1 A T 15: 75,597,721 probably benign Het
Greb1 T C 12: 16,724,857 T180A possibly damaging Het
Gsdme C T 6: 50,246,012 V108M possibly damaging Het
Gtpbp4 T C 13: 8,989,066 Y157C probably benign Het
Hivep1 T A 13: 42,158,753 F1490I probably benign Het
Il17ra T C 6: 120,482,207 V773A probably benign Het
Kctd8 T A 5: 69,110,733 T345S probably benign Het
Kdm3b T C 18: 34,824,710 S1243P probably benign Het
Klhdc1 T C 12: 69,251,938 V99A possibly damaging Het
Lars T G 18: 42,221,547 E778D probably benign Het
Map7 C T 10: 20,261,918 R279* probably null Het
Mdp1 C T 14: 55,659,226 R126Q probably damaging Het
Mtbp A G 15: 55,603,187 D532G probably benign Het
Necab1 A G 4: 14,947,503 probably benign Het
Nisch C T 14: 31,187,229 probably benign Het
Nlrp1a T C 11: 71,122,705 D573G probably benign Het
Noct C A 3: 51,248,061 N83K probably damaging Het
Olfr1349 A G 7: 6,514,547 L294P probably damaging Het
Olfr1368 T C 13: 21,142,265 N264S probably benign Het
Olfr362 C T 2: 37,105,455 R65H possibly damaging Het
Olfr446 C A 6: 42,927,433 D67E probably damaging Het
Olfr503 A G 7: 108,544,848 I106V probably benign Het
Olfr524 C T 7: 140,201,838 A311T probably benign Het
Olfr770 T C 10: 129,133,615 H51R probably benign Het
Osgepl1 T A 1: 53,318,180 V167D probably damaging Het
Pabpc6 T C 17: 9,668,560 E354G probably damaging Het
Pgghg A C 7: 140,943,390 D194A probably benign Het
Podnl1 A T 8: 84,126,258 H19L probably benign Het
Pold1 G T 7: 44,533,902 A977E probably benign Het
Poldip3 T C 15: 83,133,194 T227A probably damaging Het
Prss43 A G 9: 110,827,421 S59G possibly damaging Het
Ptpn14 T A 1: 189,850,534 I526N probably benign Het
Ptprb T C 10: 116,348,127 S1615P possibly damaging Het
Ptpro A G 6: 137,377,132 K169E probably damaging Het
Rab15 T C 12: 76,800,567 E114G probably damaging Het
Rcvrn A G 11: 67,695,724 E103G probably benign Het
Repin1 T A 6: 48,594,845 probably benign Het
Rita1 T A 5: 120,611,383 K88N probably damaging Het
Rtkn2 T C 10: 68,041,409 V433A probably benign Het
Runx1t1 T C 4: 13,865,231 I314T possibly damaging Het
Serpinb9c A C 13: 33,154,431 S190A probably benign Het
Shank2 C A 7: 144,070,179 H300Q probably benign Het
Slc4a4 A G 5: 89,149,298 probably null Het
Slc5a8 T C 10: 88,909,654 S375P probably benign Het
Spata5 T A 3: 37,433,277 probably benign Het
Spns3 C A 11: 72,537,201 W251L probably damaging Het
Spta1 A G 1: 174,240,223 N2072S possibly damaging Het
Sptbn1 A G 11: 30,124,016 V1351A probably benign Het
Sytl2 A T 7: 90,381,315 probably benign Het
Tax1bp1 A G 6: 52,729,493 probably benign Het
Tg A G 15: 66,696,586 D1374G probably benign Het
Tlr1 A G 5: 64,926,224 S337P probably damaging Het
Trp63 A T 16: 25,868,227 D303V probably damaging Het
Ttn G A 2: 76,852,906 probably benign Het
Txndc5 T C 13: 38,528,184 probably null Het
Vmn2r77 T G 7: 86,801,807 D300E possibly damaging Het
Zfp729a A T 13: 67,620,246 N621K probably benign Het
Other mutations in Mylk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01384:Mylk APN 16 34938952 missense probably benign 0.36
IGL01386:Mylk APN 16 34971240 critical splice acceptor site probably null
IGL01684:Mylk APN 16 34971940 missense possibly damaging 0.55
IGL01884:Mylk APN 16 34988877 splice site probably benign
IGL02079:Mylk APN 16 34860631 missense possibly damaging 0.87
IGL02104:Mylk APN 16 34815435 missense probably benign 0.06
IGL02624:Mylk APN 16 34929896 missense probably benign 0.29
IGL02756:Mylk APN 16 34963646 missense probably benign 0.42
IGL02794:Mylk APN 16 34986541 missense probably benign 0.21
IGL02833:Mylk APN 16 34914900 missense probably benign 0.01
IGL02946:Mylk APN 16 34921788 missense probably benign 0.10
IGL03012:Mylk APN 16 34952781 missense probably benign 0.03
IGL03093:Mylk APN 16 34912192 missense possibly damaging 0.62
IGL03272:Mylk APN 16 34979189 missense probably benign 0.09
billy UTSW 16 34875620 missense probably damaging 0.97
brutus UTSW 16 34953695 missense probably benign 0.12
Club UTSW 16 34912275 nonsense probably null
popeye UTSW 16 34963577 missense probably benign 0.29
F5770:Mylk UTSW 16 34995204 critical splice donor site probably null
P4717OSA:Mylk UTSW 16 34977113 splice site probably benign
PIT4382001:Mylk UTSW 16 34875642 missense probably damaging 0.99
R0131:Mylk UTSW 16 34875504 missense probably benign 0.03
R0309:Mylk UTSW 16 34912297 splice site probably benign
R0358:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0381:Mylk UTSW 16 34784974 splice site probably null
R0390:Mylk UTSW 16 34875620 missense probably damaging 0.97
R0413:Mylk UTSW 16 34921944 missense probably benign 0.01
R0536:Mylk UTSW 16 35000387 missense possibly damaging 0.95
R0544:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0545:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0546:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0547:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0548:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0627:Mylk UTSW 16 35000429 missense probably damaging 1.00
R0726:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0755:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0782:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0783:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0784:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R1136:Mylk UTSW 16 35000318 missense probably damaging 1.00
R1170:Mylk UTSW 16 34874039 missense probably benign 0.20
R1222:Mylk UTSW 16 34860652 missense probably benign 0.12
R1445:Mylk UTSW 16 34815465 missense possibly damaging 0.57
R1583:Mylk UTSW 16 34875586 missense probably benign 0.29
R1618:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R1643:Mylk UTSW 16 34875635 missense probably benign 0.03
R1702:Mylk UTSW 16 34921944 missense probably benign 0.00
R1776:Mylk UTSW 16 34952782 missense probably benign 0.16
R1865:Mylk UTSW 16 34912230 missense probably benign 0.03
R1975:Mylk UTSW 16 34880303 splice site probably null
R2016:Mylk UTSW 16 34996817 missense probably damaging 1.00
R2045:Mylk UTSW 16 34953653 missense probably benign 0.29
R2134:Mylk UTSW 16 34986476 missense probably benign 0.13
R3547:Mylk UTSW 16 34880168 missense possibly damaging 0.61
R3844:Mylk UTSW 16 34921877 missense probably benign 0.01
R4003:Mylk UTSW 16 34963577 missense probably benign 0.29
R4396:Mylk UTSW 16 34912275 nonsense probably null
R4470:Mylk UTSW 16 34912152 missense probably benign 0.09
R4507:Mylk UTSW 16 34953695 missense probably benign 0.12
R4700:Mylk UTSW 16 34922435 missense probably benign 0.16
R4751:Mylk UTSW 16 34879169 missense probably benign 0.29
R4815:Mylk UTSW 16 34894925 missense probably damaging 0.97
R4832:Mylk UTSW 16 34922367 missense probably benign 0.36
R4872:Mylk UTSW 16 34914990 missense possibly damaging 0.89
R4953:Mylk UTSW 16 34988961 missense probably damaging 1.00
R4969:Mylk UTSW 16 34971440 missense probably damaging 0.96
R5130:Mylk UTSW 16 34988997 missense probably damaging 1.00
R5173:Mylk UTSW 16 34977013 missense probably benign 0.40
R5195:Mylk UTSW 16 34979215 missense probably damaging 1.00
R5209:Mylk UTSW 16 34922625 missense possibly damaging 0.55
R5311:Mylk UTSW 16 34921757 missense probably benign 0.01
R5418:Mylk UTSW 16 34912230 missense probably benign 0.02
R5481:Mylk UTSW 16 34921604 missense probably benign 0.09
R5590:Mylk UTSW 16 34879352 missense probably benign 0.29
R5603:Mylk UTSW 16 34956492 missense probably benign 0.06
R5823:Mylk UTSW 16 34894947 critical splice donor site probably null
R6290:Mylk UTSW 16 34894843 missense probably benign 0.39
R6351:Mylk UTSW 16 34921971 missense probably benign 0.01
R6365:Mylk UTSW 16 34860591 missense probably benign 0.12
R6490:Mylk UTSW 16 34929867 missense possibly damaging 0.74
R6723:Mylk UTSW 16 34929888 missense possibly damaging 0.74
R6864:Mylk UTSW 16 34874150 missense probably benign 0.03
R6908:Mylk UTSW 16 34880273 missense probably benign 0.18
R6949:Mylk UTSW 16 35000318 missense probably damaging 1.00
R7018:Mylk UTSW 16 35000426 missense possibly damaging 0.88
R7035:Mylk UTSW 16 34976982 missense possibly damaging 0.89
R7162:Mylk UTSW 16 34922529 missense probably damaging 1.00
R7236:Mylk UTSW 16 34922529 missense probably damaging 1.00
R7269:Mylk UTSW 16 34785011 missense probably damaging 0.96
R7475:Mylk UTSW 16 34914076 splice site probably null
R7525:Mylk UTSW 16 34988987 missense probably benign 0.06
R7587:Mylk UTSW 16 34922517 missense probably benign 0.29
R7607:Mylk UTSW 16 34894814 missense probably benign 0.09
R7616:Mylk UTSW 16 34879557 missense probably damaging 0.97
R7647:Mylk UTSW 16 34879524 missense probably benign 0.29
R7648:Mylk UTSW 16 34879524 missense probably benign 0.29
R7764:Mylk UTSW 16 34922183 missense probably benign 0.16
R7890:Mylk UTSW 16 34963648 nonsense probably null
R7892:Mylk UTSW 16 34879524 missense probably benign 0.29
R7893:Mylk UTSW 16 34879524 missense probably benign 0.29
R8065:Mylk UTSW 16 34972019 missense probably benign 0.08
R8067:Mylk UTSW 16 34972019 missense probably benign 0.08
R8143:Mylk UTSW 16 34914155 missense possibly damaging 0.87
R8210:Mylk UTSW 16 35000351 missense probably damaging 1.00
R8271:Mylk UTSW 16 34922579 missense probably damaging 0.97
R8540:Mylk UTSW 16 34929887 missense possibly damaging 0.87
R8721:Mylk UTSW 16 34996806 missense probably damaging 1.00
R8743:Mylk UTSW 16 34921057 missense probably benign 0.03
R8798:Mylk UTSW 16 34899402 missense possibly damaging 0.89
R8956:Mylk UTSW 16 34971409 missense probably benign 0.01
R9131:Mylk UTSW 16 34956465 missense probably benign 0.29
R9403:Mylk UTSW 16 34875642 nonsense probably null
R9624:Mylk UTSW 16 34879307 missense probably benign 0.29
R9735:Mylk UTSW 16 34914809 missense probably benign 0.09
R9756:Mylk UTSW 16 34914017 missense probably damaging 0.96
R9763:Mylk UTSW 16 34879112 nonsense probably null
RF001:Mylk UTSW 16 34879371 missense probably benign 0.03
V7580:Mylk UTSW 16 34995204 critical splice donor site probably null
V7583:Mylk UTSW 16 34995204 critical splice donor site probably null
X0065:Mylk UTSW 16 35000441 missense probably damaging 1.00
Z1177:Mylk UTSW 16 34922651 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- AAGCGTCATGACAGTTGCC -3'
(R):5'- TTGTCCCTAGATGGTCCAGG -3'

Sequencing Primer
(F):5'- GATGGAGCACTACCACCAGG -3'
(R):5'- TAGATGGTCCAGGAGCCC -3'
Posted On 2016-06-06