Incidental Mutation 'R5009:Pabpc6'
ID390401
Institutional Source Beutler Lab
Gene Symbol Pabpc6
Ensembl Gene ENSMUSG00000046173
Gene Namepoly(A) binding protein, cytoplasmic 6
Synonyms4932702K14Rik
MMRRC Submission 042600-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R5009 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location9666497-9669704 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 9668560 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 354 (E354G)
Ref Sequence ENSEMBL: ENSMUSP00000050792 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057190]
Predicted Effect probably damaging
Transcript: ENSMUST00000057190
AA Change: E354G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000050792
Gene: ENSMUSG00000046173
AA Change: E354G

DomainStartEndE-ValueType
RRM 12 85 1.78e-20 SMART
RRM 100 171 2.54e-25 SMART
RRM 192 264 1.08e-28 SMART
RRM 305 376 7.57e-24 SMART
low complexity region 500 511 N/A INTRINSIC
PolyA 561 624 3.28e-34 SMART
Meta Mutation Damage Score 0.0704 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 100% (91/91)
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aim2 T C 1: 173,455,366 Y5H probably damaging Het
Atp7b A G 8: 22,027,698 S375P possibly damaging Het
BC106179 C A 16: 23,224,442 probably benign Het
Brinp3 T A 1: 146,901,049 N411K probably benign Het
Cacna1d A G 14: 30,079,332 V1386A probably damaging Het
Cuzd1 T A 7: 131,311,523 Y455F probably damaging Het
Dctd C T 8: 48,137,414 probably benign Het
Dip2b T A 15: 100,195,784 probably null Het
Dot1l G T 10: 80,771,196 R108L probably benign Het
Dysf T C 6: 84,151,986 S1413P probably damaging Het
Eea1 C A 10: 96,011,021 R388S probably benign Het
Elavl1 C T 8: 4,301,723 R131Q probably benign Het
Erich6b A G 14: 75,665,156 T138A possibly damaging Het
Esr1 C T 10: 4,712,394 T4I probably damaging Het
Ets1 T C 9: 32,732,999 S152P possibly damaging Het
Fam214a G A 9: 75,008,889 E257K probably damaging Het
Flrt2 T C 12: 95,779,773 V295A probably damaging Het
Fuk C T 8: 110,887,830 C609Y probably damaging Het
Gm13196 A G 2: 4,700,338 noncoding transcript Het
Gm1966 A G 7: 106,601,560 noncoding transcript Het
Gm5965 T A 16: 88,778,424 Y162N probably benign Het
Gm7853 A T 14: 36,089,509 noncoding transcript Het
Gm8126 C T 14: 43,261,608 A178V probably benign Het
Gpihbp1 A T 15: 75,597,721 probably benign Het
Greb1 T C 12: 16,724,857 T180A possibly damaging Het
Gsdme C T 6: 50,246,012 V108M possibly damaging Het
Gtpbp4 T C 13: 8,989,066 Y157C probably benign Het
Hivep1 T A 13: 42,158,753 F1490I probably benign Het
Il17ra T C 6: 120,482,207 V773A probably benign Het
Kctd8 T A 5: 69,110,733 T345S probably benign Het
Kdm3b T C 18: 34,824,710 S1243P probably benign Het
Klhdc1 T C 12: 69,251,938 V99A possibly damaging Het
Lars T G 18: 42,221,547 E778D probably benign Het
Map7 C T 10: 20,261,918 R279* probably null Het
Mdp1 C T 14: 55,659,226 R126Q probably damaging Het
Mtbp A G 15: 55,603,187 D532G probably benign Het
Mylk G A 16: 34,899,507 V597I probably benign Het
Necab1 A G 4: 14,947,503 probably benign Het
Nisch C T 14: 31,187,229 probably benign Het
Nlrp1a T C 11: 71,122,705 D573G probably benign Het
Noct C A 3: 51,248,061 N83K probably damaging Het
Olfr1349 A G 7: 6,514,547 L294P probably damaging Het
Olfr1368 T C 13: 21,142,265 N264S probably benign Het
Olfr362 C T 2: 37,105,455 R65H possibly damaging Het
Olfr446 C A 6: 42,927,433 D67E probably damaging Het
Olfr503 A G 7: 108,544,848 I106V probably benign Het
Olfr524 C T 7: 140,201,838 A311T probably benign Het
Olfr770 T C 10: 129,133,615 H51R probably benign Het
Osgepl1 T A 1: 53,318,180 V167D probably damaging Het
Pgghg A C 7: 140,943,390 D194A probably benign Het
Podnl1 A T 8: 84,126,258 H19L probably benign Het
Pold1 G T 7: 44,533,902 A977E probably benign Het
Poldip3 T C 15: 83,133,194 T227A probably damaging Het
Prss43 A G 9: 110,827,421 S59G possibly damaging Het
Ptpn14 T A 1: 189,850,534 I526N probably benign Het
Ptprb T C 10: 116,348,127 S1615P possibly damaging Het
Ptpro A G 6: 137,377,132 K169E probably damaging Het
Rab15 T C 12: 76,800,567 E114G probably damaging Het
Rcvrn A G 11: 67,695,724 E103G probably benign Het
Repin1 T A 6: 48,594,845 probably benign Het
Rita1 T A 5: 120,611,383 K88N probably damaging Het
Rtkn2 T C 10: 68,041,409 V433A probably benign Het
Runx1t1 T C 4: 13,865,231 I314T possibly damaging Het
Serpinb9c A C 13: 33,154,431 S190A probably benign Het
Shank2 C A 7: 144,070,179 H300Q probably benign Het
Slc4a4 A G 5: 89,149,298 probably null Het
Slc5a8 T C 10: 88,909,654 S375P probably benign Het
Spata5 T A 3: 37,433,277 probably benign Het
Spns3 C A 11: 72,537,201 W251L probably damaging Het
Spta1 A G 1: 174,240,223 N2072S possibly damaging Het
Sptbn1 A G 11: 30,124,016 V1351A probably benign Het
Sytl2 A T 7: 90,381,315 probably benign Het
Tax1bp1 A G 6: 52,729,493 probably benign Het
Tg A G 15: 66,696,586 D1374G probably benign Het
Tlr1 A G 5: 64,926,224 S337P probably damaging Het
Trp63 A T 16: 25,868,227 D303V probably damaging Het
Ttn G A 2: 76,852,906 probably benign Het
Txndc5 T C 13: 38,528,184 probably null Het
Vmn2r77 T G 7: 86,801,807 D300E possibly damaging Het
Zfp729a A T 13: 67,620,246 N621K probably benign Het
Other mutations in Pabpc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00591:Pabpc6 APN 17 9668498 missense possibly damaging 0.80
IGL00984:Pabpc6 APN 17 9668689 missense probably damaging 1.00
IGL01123:Pabpc6 APN 17 9668147 missense probably benign 0.01
IGL01301:Pabpc6 APN 17 9667970 missense probably benign
IGL02347:Pabpc6 APN 17 9669064 missense probably benign 0.03
ANU18:Pabpc6 UTSW 17 9667970 missense probably benign
R0022:Pabpc6 UTSW 17 9669216 missense probably benign 0.19
R0022:Pabpc6 UTSW 17 9669216 missense probably benign 0.19
R1593:Pabpc6 UTSW 17 9667813 missense probably damaging 0.98
R1695:Pabpc6 UTSW 17 9668074 missense probably benign 0.01
R3897:Pabpc6 UTSW 17 9669127 missense probably benign 0.38
R3903:Pabpc6 UTSW 17 9669154 missense probably benign 0.16
R4585:Pabpc6 UTSW 17 9669073 missense probably damaging 1.00
R5112:Pabpc6 UTSW 17 9669611 missense probably damaging 1.00
R5769:Pabpc6 UTSW 17 9667843 nonsense probably null
R6174:Pabpc6 UTSW 17 9668155 missense probably benign
R6488:Pabpc6 UTSW 17 9669599 missense probably damaging 1.00
R7140:Pabpc6 UTSW 17 9668428 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- TGTCATGCAGTAACCTGACG -3'
(R):5'- CACAAATTCGGGCAGATGAAGC -3'

Sequencing Primer
(F):5'- AGTAACCTGACGGCCCCTG -3'
(R):5'- TACCACAAGATAGAAGCGTCAGATGC -3'
Posted On2016-06-06