Mutagenetix > Incidental Mutation

Incidental Mutation 'R5010:Gm597'

390405

Institutional Source

Beutler Lab

Gene Symbol

Gm597

Ensembl Gene

ENSMUSG00000048411

Gene Name

predicted gene 597

Synonyms

LOC210962

MMRRC Submission

042601-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.062) question?

Stock #

R5010 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

28776117-28780252 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 28777862 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 363 (I363T)

Ref Sequence

ENSEMBL: ENSMUSP00000058140 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000059937]

AlphaFold

E9Q8J5

Predicted Effect

possibly damaging
Transcript: ENSMUST00000059937
AA Change: I363T

PolyPhen 2 Score 0.519 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000058140
Gene: ENSMUSG00000048411
AA Change: I363T

Domain	Start	End	E-Value	Type
transmembrane domain	13	35	N/A	INTRINSIC
low complexity region	112	129	N/A	INTRINSIC
Pfam:FAM75	137	472	8.1e-14	PFAM
low complexity region	664	675	N/A	INTRINSIC
internal_repeat_1	718	807	1.4e-5	PROSPERO
internal_repeat_1	807	894	1.4e-5	PROSPERO

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.6%

Validation Efficiency

98% (65/66)

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810065E05Rik	C	T	11: 58,422,804	A86V	possibly damaging	Het
9430097D07Rik	A	G	2: 32,574,428		probably benign	Het
Actr5	T	A	2: 158,635,363	D411E	probably benign	Het
Ang5	A	G	14: 43,962,845	D122G	probably benign	Het
Atg9a	A	T	1: 75,186,060		probably null	Het
C530008M17Rik	G	C	5: 76,657,834		probably benign	Het
Dctd	C	T	8: 48,137,414		probably benign	Het
Ddx11	G	A	17: 66,147,722	V642M	possibly damaging	Het
Dis3l2	G	A	1: 86,760,321	V100I	probably benign	Het
Echdc2	T	C	4: 108,172,131	V111A	probably benign	Het
Egr1	A	G	18: 34,863,658	T498A	probably benign	Het
Exosc3	T	C	4: 45,317,702	K200R	possibly damaging	Het
Exosc8	T	C	3: 54,729,223	D229G	probably benign	Het
Ext1	T	A	15: 53,092,412	I430F	probably damaging	Het
Fbxw22	T	C	9: 109,403,424	N31S	probably benign	Het
Gja8	T	C	3: 96,919,849	T166A	probably benign	Het
Gm21814	T	A	6: 149,583,618		noncoding transcript	Het
Gm21915	T	A	9: 40,670,648	H12Q	probably benign	Het
Hgsnat	G	A	8: 25,947,960	R527*	probably null	Het
Iqgap2	A	G	13: 95,673,743	F731S	probably benign	Het
Jchain	T	C	5: 88,522,505	H85R	probably damaging	Het
Kcnb2	T	C	1: 15,312,962	C171R	probably benign	Het
Kcnk3	C	A	5: 30,622,805	R400S	possibly damaging	Het
Klhl28	C	T	12: 64,957,227	E171K	probably damaging	Het
Lrrfip2	T	C	9: 111,223,972	I375T	possibly damaging	Het
Mccc1	T	C	3: 35,979,017	N326S	probably benign	Het
Med13l	T	C	5: 118,593,550	V97A	possibly damaging	Het
Mertk	C	A	2: 128,784,000	T685K	probably benign	Het
Msh2	C	A	17: 87,723,413	A906E	probably benign	Het
Myom2	G	A	8: 15,083,310	V401M	probably damaging	Het
Nme5	A	C	18: 34,578,685	M1R	probably null	Het
Nop2	T	C	6: 125,133,763	S68P	probably benign	Het
Notch1	A	T	2: 26,476,114	D809E	possibly damaging	Het
Olfr292	T	C	7: 86,694,585	I43T	possibly damaging	Het
Ppat	C	T	5: 76,928,678		probably benign	Het
Prss23	T	A	7: 89,510,214	M216L	probably benign	Het
Psg18	A	T	7: 18,349,354	V171D	probably damaging	Het
Psg28	A	G	7: 18,427,891	V229A	probably damaging	Het
Qser1	T	C	2: 104,787,831	N879D	possibly damaging	Het
Rpap1	T	C	2: 119,770,041	N879S	probably benign	Het
Rusc2	T	C	4: 43,415,926	S411P	probably damaging	Het
Rxfp2	T	A	5: 150,067,360	W519R	probably damaging	Het
Scpep1	T	A	11: 88,941,349	Q185L	probably benign	Het
Serpinb11	A	G	1: 107,379,649	N270S	probably benign	Het
Serpinb6d	T	A	13: 33,671,444	M367K	probably benign	Het
Skint10	T	G	4: 112,727,672	I213L	probably benign	Het
Skint5	T	C	4: 113,546,537	T1163A	unknown	Het
Slamf9	A	T	1: 172,476,213	I42L	possibly damaging	Het
Slc1a3	T	C	15: 8,650,846		probably benign	Het
Smad6	T	A	9: 63,953,900	Q371L	possibly damaging	Het
Snx31	A	T	15: 36,555,324	V26E	probably damaging	Het
Taf4b	A	G	18: 14,822,172	N594S	possibly damaging	Het
Tanc2	T	C	11: 105,780,092	S172P	probably damaging	Het
Tas2r110	T	A	6: 132,868,475	Y156*	probably null	Het
Tbc1d20	G	A	2: 152,293,936		probably benign	Het
Timm50	A	T	7: 28,306,859	D272E	probably benign	Het
Ttn	T	G	2: 76,900,511		probably benign	Het
Vps13c	T	A	9: 67,916,379	F1362I	probably benign	Het
Vwf	T	C	6: 125,566,257	S154P	probably benign	Het
Zfp445	T	C	9: 122,852,345	R844G	probably benign	Het

Other mutations in Gm597

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00740:Gm597	APN	1	28778651	missense	possibly damaging	0.94
IGL00885:Gm597	APN	1	28776845	missense	unknown
IGL01296:Gm597	APN	1	28777056	missense	probably benign	0.23
IGL01476:Gm597	APN	1	28777453	missense	probably benign	0.04
IGL02125:Gm597	APN	1	28776338	missense	possibly damaging	0.91
IGL02410:Gm597	APN	1	28778631	missense	probably benign	0.25
IGL02982:Gm597	APN	1	28778054	missense	probably damaging	1.00
IGL03031:Gm597	APN	1	28778583	missense	probably benign	0.03
IGL03267:Gm597	APN	1	28777121	missense	probably damaging	1.00
R0294:Gm597	UTSW	1	28778663	missense	probably benign	0.00
R0433:Gm597	UTSW	1	28777342	nonsense	probably null
R0485:Gm597	UTSW	1	28778142	missense	probably damaging	1.00
R0645:Gm597	UTSW	1	28776930	missense	probably damaging	0.99
R0744:Gm597	UTSW	1	28777821	missense	possibly damaging	0.46
R0836:Gm597	UTSW	1	28777821	missense	possibly damaging	0.46
R1036:Gm597	UTSW	1	28777802	missense	probably benign	0.01
R1302:Gm597	UTSW	1	28776340	missense	probably benign	0.00
R1394:Gm597	UTSW	1	28776809	missense	possibly damaging	0.61
R1395:Gm597	UTSW	1	28776809	missense	possibly damaging	0.61
R1514:Gm597	UTSW	1	28778748	missense	possibly damaging	0.83
R1535:Gm597	UTSW	1	28777424	missense	probably damaging	1.00
R2004:Gm597	UTSW	1	28777179	missense	probably damaging	1.00
R2021:Gm597	UTSW	1	28778153	missense	probably damaging	0.98
R2022:Gm597	UTSW	1	28778153	missense	probably damaging	0.98
R3115:Gm597	UTSW	1	28776329	missense	possibly damaging	0.92
R3615:Gm597	UTSW	1	28776575	missense	probably benign	0.26
R3616:Gm597	UTSW	1	28776575	missense	probably benign	0.26
R3862:Gm597	UTSW	1	28777641	missense	probably damaging	0.98
R4067:Gm597	UTSW	1	28777631	missense	probably damaging	0.98
R4119:Gm597	UTSW	1	28777973	missense	probably damaging	0.99
R4415:Gm597	UTSW	1	28777133	missense	probably benign	0.01
R5109:Gm597	UTSW	1	28777555	missense	possibly damaging	0.46
R5122:Gm597	UTSW	1	28780060	missense	probably benign	0.00
R5533:Gm597	UTSW	1	28778082	missense	probably damaging	1.00
R6085:Gm597	UTSW	1	28778227	missense	possibly damaging	0.55
R6116:Gm597	UTSW	1	28778699	missense	probably benign	0.01
R6750:Gm597	UTSW	1	28777414	missense	probably damaging	0.98
R6757:Gm597	UTSW	1	28780110	missense	probably damaging	0.98
R6774:Gm597	UTSW	1	28776893	missense	probably benign	0.00
R7156:Gm597	UTSW	1	28776767	missense	possibly damaging	0.53
R7365:Gm597	UTSW	1	28780152	missense	probably benign	0.04
R7739:Gm597	UTSW	1	28777608	missense	possibly damaging	0.72
R7996:Gm597	UTSW	1	28778406	missense	probably damaging	0.98
R8082:Gm597	UTSW	1	28777498	missense	probably benign	0.08
R8281:Gm597	UTSW	1	28778144	missense	possibly damaging	0.77
R8514:Gm597	UTSW	1	28778505	missense	probably damaging	1.00
R8944:Gm597	UTSW	1	28777074	missense	probably benign	0.00
R9042:Gm597	UTSW	1	28776956	missense	possibly damaging	0.72
R9101:Gm597	UTSW	1	28776659	missense	probably benign	0.04
R9106:Gm597	UTSW	1	28776894	missense	probably benign	0.00
R9173:Gm597	UTSW	1	28777349	missense	probably benign	0.22
R9596:Gm597	UTSW	1	28776607	missense	probably benign	0.07
R9632:Gm597	UTSW	1	28778039	missense	probably benign	0.20
R9656:Gm597	UTSW	1	28777455	missense	probably benign	0.02
R9659:Gm597	UTSW	1	28777455	missense	probably benign	0.02
R9661:Gm597	UTSW	1	28777455	missense	probably benign	0.02
R9663:Gm597	UTSW	1	28777455	missense	probably benign	0.02
R9710:Gm597	UTSW	1	28778039	missense	probably benign	0.20

Predicted Primers

PCR Primer
(F):5'- TCTTAGTGGACAGCATGTCTCTC -3'
(R):5'- GTCTACCATCATGAGGACCCAC -3'

Sequencing Primer
(F):5'- GGAAGGTTTTCAAGTTCCAGACCC -3'
(R):5'- TCATGAGGACCCACAGCAGG -3'

Posted On

2016-06-06