Incidental Mutation 'R5010:Atg9a'
ID 390406
Institutional Source Beutler Lab
Gene Symbol Atg9a
Ensembl Gene ENSMUSG00000033124
Gene Name autophagy related 9A
Synonyms Apg9l1
MMRRC Submission 042601-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5010 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 75157509-75168654 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 75162704 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000040689] [ENSMUST00000186744] [ENSMUST00000188347] [ENSMUST00000189665] [ENSMUST00000189702]
AlphaFold Q68FE2
Predicted Effect probably damaging
Transcript: ENSMUST00000040689
AA Change: L437Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047449
Gene: ENSMUSG00000033124
AA Change: L437Q

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Pfam:APG9 173 530 3.4e-134 PFAM
low complexity region 588 599 N/A INTRINSIC
low complexity region 607 621 N/A INTRINSIC
Blast:HELICc 692 733 1e-13 BLAST
low complexity region 734 755 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185727
Predicted Effect probably benign
Transcript: ENSMUST00000186744
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187601
Predicted Effect probably null
Transcript: ENSMUST00000187785
Predicted Effect probably null
Transcript: ENSMUST00000187785
Predicted Effect probably damaging
Transcript: ENSMUST00000188347
AA Change: L437Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139731
Gene: ENSMUSG00000033124
AA Change: L437Q

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Pfam:APG9 172 533 2.4e-140 PFAM
low complexity region 588 599 N/A INTRINSIC
low complexity region 607 621 N/A INTRINSIC
Blast:HELICc 692 733 1e-13 BLAST
low complexity region 734 755 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188430
Predicted Effect probably benign
Transcript: ENSMUST00000189665
SMART Domains Protein: ENSMUSP00000140012
Gene: ENSMUSG00000033124

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000189702
AA Change: L437Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139641
Gene: ENSMUSG00000033124
AA Change: L437Q

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Pfam:APG9 172 533 2.4e-140 PFAM
low complexity region 588 599 N/A INTRINSIC
low complexity region 607 621 N/A INTRINSIC
Blast:HELICc 692 733 1e-13 BLAST
low complexity region 734 755 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000189820
AA Change: L429Q

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Meta Mutation Damage Score 0.9213 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 98% (65/66)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation all die within 1 day of birth and display impaired autophagy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik C T 11: 58,313,630 (GRCm39) A86V possibly damaging Het
9430097D07Rik A G 2: 32,464,440 (GRCm39) probably benign Het
Actr5 T A 2: 158,477,283 (GRCm39) D411E probably benign Het
Ang5 A G 14: 44,200,302 (GRCm39) D122G probably benign Het
Cracd G C 5: 76,805,681 (GRCm39) probably benign Het
Dctd C T 8: 48,590,449 (GRCm39) probably benign Het
Ddx11 G A 17: 66,454,717 (GRCm39) V642M possibly damaging Het
Dis3l2 G A 1: 86,688,043 (GRCm39) V100I probably benign Het
Echdc2 T C 4: 108,029,328 (GRCm39) V111A probably benign Het
Egr1 A G 18: 34,996,711 (GRCm39) T498A probably benign Het
Exosc3 T C 4: 45,317,702 (GRCm39) K200R possibly damaging Het
Exosc8 T C 3: 54,636,644 (GRCm39) D229G probably benign Het
Ext1 T A 15: 52,955,808 (GRCm39) I430F probably damaging Het
Fbxw22 T C 9: 109,232,492 (GRCm39) N31S probably benign Het
Gja8 T C 3: 96,827,165 (GRCm39) T166A probably benign Het
Gm21814 T A 6: 149,485,116 (GRCm39) noncoding transcript Het
Gm21915 T A 9: 40,581,944 (GRCm39) H12Q probably benign Het
Hgsnat G A 8: 26,437,988 (GRCm39) R527* probably null Het
Iqgap2 A G 13: 95,810,251 (GRCm39) F731S probably benign Het
Jchain T C 5: 88,670,364 (GRCm39) H85R probably damaging Het
Kcnb2 T C 1: 15,383,186 (GRCm39) C171R probably benign Het
Kcnk3 C A 5: 30,780,149 (GRCm39) R400S possibly damaging Het
Klhl28 C T 12: 65,004,001 (GRCm39) E171K probably damaging Het
Lrrfip2 T C 9: 111,053,040 (GRCm39) I375T possibly damaging Het
Mccc1 T C 3: 36,033,166 (GRCm39) N326S probably benign Het
Med13l T C 5: 118,731,615 (GRCm39) V97A possibly damaging Het
Mertk C A 2: 128,625,920 (GRCm39) T685K probably benign Het
Msh2 C A 17: 88,030,841 (GRCm39) A906E probably benign Het
Myom2 G A 8: 15,133,310 (GRCm39) V401M probably damaging Het
Nme5 A C 18: 34,711,738 (GRCm39) M1R probably null Het
Nop2 T C 6: 125,110,726 (GRCm39) S68P probably benign Het
Notch1 A T 2: 26,366,126 (GRCm39) D809E possibly damaging Het
Or14c39 T C 7: 86,343,793 (GRCm39) I43T possibly damaging Het
Ppat C T 5: 77,076,525 (GRCm39) probably benign Het
Prss23 T A 7: 89,159,422 (GRCm39) M216L probably benign Het
Psg18 A T 7: 18,083,279 (GRCm39) V171D probably damaging Het
Psg28 A G 7: 18,161,816 (GRCm39) V229A probably damaging Het
Qser1 T C 2: 104,618,176 (GRCm39) N879D possibly damaging Het
Rpap1 T C 2: 119,600,522 (GRCm39) N879S probably benign Het
Rusc2 T C 4: 43,415,926 (GRCm39) S411P probably damaging Het
Rxfp2 T A 5: 149,990,825 (GRCm39) W519R probably damaging Het
Scpep1 T A 11: 88,832,175 (GRCm39) Q185L probably benign Het
Serpinb11 A G 1: 107,307,379 (GRCm39) N270S probably benign Het
Serpinb6d T A 13: 33,855,427 (GRCm39) M367K probably benign Het
Skint10 T G 4: 112,584,869 (GRCm39) I213L probably benign Het
Skint5 T C 4: 113,403,734 (GRCm39) T1163A unknown Het
Slamf9 A T 1: 172,303,780 (GRCm39) I42L possibly damaging Het
Slc1a3 T C 15: 8,680,330 (GRCm39) probably benign Het
Smad6 T A 9: 63,861,182 (GRCm39) Q371L possibly damaging Het
Snx31 A T 15: 36,555,469 (GRCm39) V26E probably damaging Het
Spata31e5 A G 1: 28,816,943 (GRCm39) I363T possibly damaging Het
Taf4b A G 18: 14,955,229 (GRCm39) N594S possibly damaging Het
Tanc2 T C 11: 105,670,918 (GRCm39) S172P probably damaging Het
Tas2r110 T A 6: 132,845,438 (GRCm39) Y156* probably null Het
Tbc1d20 G A 2: 152,135,856 (GRCm39) probably benign Het
Timm50 A T 7: 28,006,284 (GRCm39) D272E probably benign Het
Ttn T G 2: 76,730,855 (GRCm39) probably benign Het
Vps13c T A 9: 67,823,661 (GRCm39) F1362I probably benign Het
Vwf T C 6: 125,543,220 (GRCm39) S154P probably benign Het
Zfp445 T C 9: 122,681,410 (GRCm39) R844G probably benign Het
Other mutations in Atg9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01464:Atg9a APN 1 75,167,010 (GRCm39) missense probably damaging 1.00
IGL02041:Atg9a APN 1 75,159,748 (GRCm39) missense possibly damaging 0.47
IGL03367:Atg9a APN 1 75,164,601 (GRCm39) missense probably benign 0.18
PIT4494001:Atg9a UTSW 1 75,164,597 (GRCm39) nonsense probably null
R0054:Atg9a UTSW 1 75,161,143 (GRCm39) missense probably damaging 1.00
R0054:Atg9a UTSW 1 75,161,143 (GRCm39) missense probably damaging 1.00
R0408:Atg9a UTSW 1 75,161,939 (GRCm39) missense probably damaging 1.00
R0520:Atg9a UTSW 1 75,163,178 (GRCm39) nonsense probably null
R0653:Atg9a UTSW 1 75,166,972 (GRCm39) missense probably damaging 0.96
R0666:Atg9a UTSW 1 75,161,734 (GRCm39) missense probably damaging 0.99
R0961:Atg9a UTSW 1 75,163,390 (GRCm39) missense probably damaging 0.99
R1489:Atg9a UTSW 1 75,162,734 (GRCm39) missense probably damaging 1.00
R1490:Atg9a UTSW 1 75,162,389 (GRCm39) missense possibly damaging 0.70
R1692:Atg9a UTSW 1 75,166,999 (GRCm39) missense probably benign 0.04
R1997:Atg9a UTSW 1 75,166,270 (GRCm39) missense probably benign 0.33
R2005:Atg9a UTSW 1 75,162,635 (GRCm39) missense probably benign 0.18
R2172:Atg9a UTSW 1 75,162,329 (GRCm39) missense probably damaging 0.99
R4004:Atg9a UTSW 1 75,163,095 (GRCm39) missense probably damaging 1.00
R4105:Atg9a UTSW 1 75,162,603 (GRCm39) missense probably damaging 1.00
R5220:Atg9a UTSW 1 75,162,372 (GRCm39) missense probably damaging 1.00
R5898:Atg9a UTSW 1 75,162,916 (GRCm39) missense probably damaging 1.00
R6295:Atg9a UTSW 1 75,161,702 (GRCm39) missense probably benign 0.01
R6390:Atg9a UTSW 1 75,164,625 (GRCm39) missense probably damaging 1.00
R7312:Atg9a UTSW 1 75,164,736 (GRCm39) missense probably damaging 1.00
R7729:Atg9a UTSW 1 75,161,204 (GRCm39) missense probably benign 0.34
R8111:Atg9a UTSW 1 75,164,366 (GRCm39) missense probably damaging 1.00
R8210:Atg9a UTSW 1 75,163,009 (GRCm39) missense probably damaging 1.00
R8210:Atg9a UTSW 1 75,161,927 (GRCm39) missense probably damaging 1.00
R8256:Atg9a UTSW 1 75,163,563 (GRCm39) missense possibly damaging 0.88
R8319:Atg9a UTSW 1 75,162,342 (GRCm39) nonsense probably null
R8321:Atg9a UTSW 1 75,162,342 (GRCm39) nonsense probably null
R8382:Atg9a UTSW 1 75,162,342 (GRCm39) nonsense probably null
R8406:Atg9a UTSW 1 75,167,028 (GRCm39) missense probably damaging 1.00
R8482:Atg9a UTSW 1 75,162,870 (GRCm39) missense probably damaging 0.99
R8855:Atg9a UTSW 1 75,161,867 (GRCm39) missense probably damaging 1.00
R8866:Atg9a UTSW 1 75,161,867 (GRCm39) missense probably damaging 1.00
R9381:Atg9a UTSW 1 75,162,726 (GRCm39) missense probably benign
R9441:Atg9a UTSW 1 75,163,086 (GRCm39) missense possibly damaging 0.92
R9442:Atg9a UTSW 1 75,163,086 (GRCm39) missense possibly damaging 0.92
R9448:Atg9a UTSW 1 75,162,849 (GRCm39) missense probably benign 0.35
R9608:Atg9a UTSW 1 75,161,739 (GRCm39) missense possibly damaging 0.52
R9703:Atg9a UTSW 1 75,162,431 (GRCm39) missense probably damaging 0.98
RF021:Atg9a UTSW 1 75,159,273 (GRCm39) missense probably damaging 0.96
Z1176:Atg9a UTSW 1 75,163,203 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGATGGGACTCAGCAACTC -3'
(R):5'- GATGAAGATGTGTTAGCTGTGGAAC -3'

Sequencing Primer
(F):5'- AGGTTACCCGCAAGCAGGAC -3'
(R):5'- CACGTCCTCACCACGGTC -3'
Posted On 2016-06-06