Incidental Mutation 'R5010:Dis3l2'
ID390407
Institutional Source Beutler Lab
Gene Symbol Dis3l2
Ensembl Gene ENSMUSG00000053333
Gene NameDIS3 like 3'-5' exoribonuclease 2
Synonyms4930429A22Rik, 8030493P09Rik
MMRRC Submission 042601-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.274) question?
Stock #R5010 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location86703808-87050095 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 86760321 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 100 (V100I)
Ref Sequence ENSEMBL: ENSMUSP00000139579 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065694] [ENSMUST00000168237] [ENSMUST00000190618]
Predicted Effect probably benign
Transcript: ENSMUST00000065694
AA Change: V100I

PolyPhen 2 Score 0.198 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000070506
Gene: ENSMUSG00000053333
AA Change: V100I

DomainStartEndE-ValueType
low complexity region 12 33 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
RNB 369 719 8.9e-140 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168237
AA Change: V100I

PolyPhen 2 Score 0.198 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000132673
Gene: ENSMUSG00000053333
AA Change: V100I

DomainStartEndE-ValueType
low complexity region 12 33 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
RNB 383 733 8.9e-140 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189044
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190273
Predicted Effect probably benign
Transcript: ENSMUST00000190618
AA Change: V100I

PolyPhen 2 Score 0.211 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000139579
Gene: ENSMUSG00000053333
AA Change: V100I

DomainStartEndE-ValueType
low complexity region 12 33 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
PDB:2VNU|D 50 123 4e-10 PDB
Meta Mutation Damage Score 0.0759 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar in sequence to 3'/5' exonucleolytic subunits of the RNA exosome. The exosome is a large multimeric ribonucleotide complex responsible for degrading various RNA substrates. Several transcript variants, some protein-coding and some not, have been found for this gene. [provided by RefSeq, Mar 2012]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik C T 11: 58,422,804 A86V possibly damaging Het
9430097D07Rik A G 2: 32,574,428 probably benign Het
Actr5 T A 2: 158,635,363 D411E probably benign Het
Ang5 A G 14: 43,962,845 D122G probably benign Het
Atg9a A T 1: 75,186,060 probably null Het
C530008M17Rik G C 5: 76,657,834 probably benign Het
Dctd C T 8: 48,137,414 probably benign Het
Ddx11 G A 17: 66,147,722 V642M possibly damaging Het
Echdc2 T C 4: 108,172,131 V111A probably benign Het
Egr1 A G 18: 34,863,658 T498A probably benign Het
Exosc3 T C 4: 45,317,702 K200R possibly damaging Het
Exosc8 T C 3: 54,729,223 D229G probably benign Het
Ext1 T A 15: 53,092,412 I430F probably damaging Het
Fbxw22 T C 9: 109,403,424 N31S probably benign Het
Gja8 T C 3: 96,919,849 T166A probably benign Het
Gm21814 T A 6: 149,583,618 noncoding transcript Het
Gm21915 T A 9: 40,670,648 H12Q probably benign Het
Gm597 A G 1: 28,777,862 I363T possibly damaging Het
Hgsnat G A 8: 25,947,960 R527* probably null Het
Iqgap2 A G 13: 95,673,743 F731S probably benign Het
Jchain T C 5: 88,522,505 H85R probably damaging Het
Kcnb2 T C 1: 15,312,962 C171R probably benign Het
Kcnk3 C A 5: 30,622,805 R400S possibly damaging Het
Klhl28 C T 12: 64,957,227 E171K probably damaging Het
Lrrfip2 T C 9: 111,223,972 I375T possibly damaging Het
Mccc1 T C 3: 35,979,017 N326S probably benign Het
Med13l T C 5: 118,593,550 V97A possibly damaging Het
Mertk C A 2: 128,784,000 T685K probably benign Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Myom2 G A 8: 15,083,310 V401M probably damaging Het
Nme5 A C 18: 34,578,685 M1R probably null Het
Nop2 T C 6: 125,133,763 S68P probably benign Het
Notch1 A T 2: 26,476,114 D809E possibly damaging Het
Olfr292 T C 7: 86,694,585 I43T possibly damaging Het
Ppat C T 5: 76,928,678 probably benign Het
Prss23 T A 7: 89,510,214 M216L probably benign Het
Psg18 A T 7: 18,349,354 V171D probably damaging Het
Psg28 A G 7: 18,427,891 V229A probably damaging Het
Qser1 T C 2: 104,787,831 N879D possibly damaging Het
Rpap1 T C 2: 119,770,041 N879S probably benign Het
Rusc2 T C 4: 43,415,926 S411P probably damaging Het
Rxfp2 T A 5: 150,067,360 W519R probably damaging Het
Scpep1 T A 11: 88,941,349 Q185L probably benign Het
Serpinb11 A G 1: 107,379,649 N270S probably benign Het
Serpinb6d T A 13: 33,671,444 M367K probably benign Het
Skint10 T G 4: 112,727,672 I213L probably benign Het
Skint5 T C 4: 113,546,537 T1163A unknown Het
Slamf9 A T 1: 172,476,213 I42L possibly damaging Het
Slc1a3 T C 15: 8,650,846 probably benign Het
Smad6 T A 9: 63,953,900 Q371L possibly damaging Het
Snx31 A T 15: 36,555,324 V26E probably damaging Het
Taf4b A G 18: 14,822,172 N594S possibly damaging Het
Tanc2 T C 11: 105,780,092 S172P probably damaging Het
Tas2r110 T A 6: 132,868,475 Y156* probably null Het
Tbc1d20 G A 2: 152,293,936 probably benign Het
Timm50 A T 7: 28,306,859 D272E probably benign Het
Ttn T G 2: 76,900,511 probably benign Het
Vps13c T A 9: 67,916,379 F1362I probably benign Het
Vwf T C 6: 125,566,257 S154P probably benign Het
Zfp445 T C 9: 122,852,345 R844G probably benign Het
Other mutations in Dis3l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01382:Dis3l2 APN 1 86857203 missense probably benign 0.00
IGL01607:Dis3l2 APN 1 86745487 missense probably benign 0.04
IGL02233:Dis3l2 APN 1 86990231 missense probably damaging 1.00
IGL02698:Dis3l2 APN 1 87048829 splice site probably benign
R0514:Dis3l2 UTSW 1 87047092 missense probably damaging 1.00
R0893:Dis3l2 UTSW 1 87044206 splice site probably null
R1086:Dis3l2 UTSW 1 86990149 missense probably benign 0.36
R1140:Dis3l2 UTSW 1 86821438 missense probably benign 0.00
R1509:Dis3l2 UTSW 1 87021086 missense possibly damaging 0.91
R2029:Dis3l2 UTSW 1 86854467 splice site probably benign
R2511:Dis3l2 UTSW 1 86990258 missense probably benign 0.05
R3772:Dis3l2 UTSW 1 86854408 missense probably benign
R4163:Dis3l2 UTSW 1 86821237 missense probably benign 0.00
R4547:Dis3l2 UTSW 1 87049671 missense probably benign 0.00
R4548:Dis3l2 UTSW 1 87049671 missense probably benign 0.00
R4650:Dis3l2 UTSW 1 86990321 missense possibly damaging 0.83
R4810:Dis3l2 UTSW 1 87047574 missense probably damaging 0.99
R4936:Dis3l2 UTSW 1 87044168 missense probably benign 0.00
R5040:Dis3l2 UTSW 1 86857337 missense probably damaging 0.98
R5272:Dis3l2 UTSW 1 86973404 missense possibly damaging 0.72
R5500:Dis3l2 UTSW 1 87021119 critical splice donor site probably null
R5556:Dis3l2 UTSW 1 86973404 missense possibly damaging 0.72
R5772:Dis3l2 UTSW 1 86878432 missense probably damaging 1.00
R5808:Dis3l2 UTSW 1 87049638 missense possibly damaging 0.94
R5950:Dis3l2 UTSW 1 87021108 missense probably damaging 0.96
R6328:Dis3l2 UTSW 1 86854431 missense probably benign 0.05
R6553:Dis3l2 UTSW 1 86745494 missense probably damaging 1.00
R6585:Dis3l2 UTSW 1 86745494 missense probably damaging 1.00
R6905:Dis3l2 UTSW 1 87044839 missense probably benign 0.00
R6921:Dis3l2 UTSW 1 86857341 missense probably benign
R7162:Dis3l2 UTSW 1 87044030 missense possibly damaging 0.94
R7270:Dis3l2 UTSW 1 86990303 missense possibly damaging 0.49
R7438:Dis3l2 UTSW 1 86745500 critical splice donor site probably null
X0027:Dis3l2 UTSW 1 86760351 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GCCTCAGCTAGTCTGTTCTTAGG -3'
(R):5'- GACTTCAAATCCCCATTGAATAGC -3'

Sequencing Primer
(F):5'- TGGGACTTGAACTCAGGACCTTC -3'
(R):5'- TGAATAGCCTTATTCACAGGCAAAAC -3'
Posted On2016-06-06