Incidental Mutation 'R5010:Notch1'
ID390410
Institutional Source Beutler Lab
Gene Symbol Notch1
Ensembl Gene ENSMUSG00000026923
Gene Namenotch 1
SynonymsTan1, 9930111A19Rik, Mis6, Motch A, lin-12, N1
MMRRC Submission 042601-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5010 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location26457903-26516663 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 26476114 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 809 (D809E)
Ref Sequence ENSEMBL: ENSMUSP00000028288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028288] [ENSMUST00000132820]
PDB Structure
The Crystal Structure of a Partial Mouse Notch-1 Ankyrin Domain: Repeats 4 Through 7 Preserve an Ankyrin Fold [X-RAY DIFFRACTION]
Mouse Notch 1 Ankyrin Repeat Intracellular Domain [X-RAY DIFFRACTION]
Structure of sugar modified epidermal growth factor-like repeat 12 of mouse Notch-1 receptor [SOLUTION NMR]
Structure of epidermal growth factor-like repeat 12 of mouse Notch-1 receptor [SOLUTION NMR]
Structure of O-fucosylated epidermal growth factor-like repeat 12 of mouse Notch-1 receptor [SOLUTION NMR]
Factor inhibiting HIF-1 Alpha in complex with Notch 1 fragment mouse notch (1930-1949) peptide [X-RAY DIFFRACTION]
Factor inhibiting HIF-1 Alpha in complex with Notch 1 fragment mouse notch (1997-2016) peptide [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028288
AA Change: D809E

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000028288
Gene: ENSMUSG00000026923
AA Change: D809E

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
EGF 23 58 1.63e1 SMART
EGF 62 99 4.29e-5 SMART
EGF 105 139 6.25e-7 SMART
EGF_CA 140 176 1.02e-6 SMART
EGF_CA 178 216 4.21e-13 SMART
EGF 221 255 6.7e-7 SMART
EGF_CA 257 293 6.8e-8 SMART
EGF_CA 295 333 1.16e-10 SMART
EGF_CA 335 371 3.17e-8 SMART
EGF 375 410 5.32e-1 SMART
EGF_CA 412 450 4.59e-14 SMART
EGF_CA 452 488 1.02e-11 SMART
EGF_CA 490 526 4.81e-8 SMART
EGF_CA 528 564 3.19e-13 SMART
EGF_CA 566 601 1.91e-11 SMART
EGF_CA 603 639 1.78e-11 SMART
EGF_CA 641 676 9.62e-8 SMART
EGF_CA 678 714 2.38e-12 SMART
EGF_CA 716 751 5.23e-9 SMART
EGF_CA 753 789 6.25e-7 SMART
EGF_CA 791 827 1.1e-11 SMART
EGF 832 867 2.03e-6 SMART
EGF_CA 869 905 5.73e-15 SMART
EGF_CA 907 943 4.56e-9 SMART
EGF_CA 945 981 1.64e-10 SMART
EGF_CA 983 1019 5.83e-7 SMART
EGF_CA 1021 1057 1.05e-13 SMART
EGF 1062 1095 8.12e-6 SMART
EGF 1100 1143 5.66e-5 SMART
EGF_CA 1145 1181 1.1e-11 SMART
EGF_CA 1183 1219 3.87e-12 SMART
EGF_CA 1221 1265 2.89e-11 SMART
EGF_CA 1267 1305 1.2e-8 SMART
EGF 1310 1346 5.74e-6 SMART
EGF 1351 1384 4.1e-2 SMART
EGF 1390 1426 2.66e-1 SMART
NL 1442 1480 4.08e-16 SMART
NL 1483 1522 1.08e-15 SMART
NL 1523 1562 7.39e-14 SMART
NOD 1566 1622 1.81e-32 SMART
NODP 1660 1722 3.27e-30 SMART
low complexity region 1729 1746 N/A INTRINSIC
ANK 1870 1912 1.07e2 SMART
ANK 1917 1946 4.82e-3 SMART
ANK 1950 1980 6.71e-2 SMART
ANK 1984 2013 1.23e0 SMART
ANK 2017 2046 9.13e-4 SMART
ANK 2050 2079 2.97e-3 SMART
low complexity region 2205 2222 N/A INTRINSIC
low complexity region 2364 2395 N/A INTRINSIC
DUF3454 2453 2517 2.01e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132820
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NOTCH family of proteins. Members of this Type I transmembrane protein family share structural characteristics including an extracellular domain consisting of multiple epidermal growth factor-like (EGF) repeats, and an intracellular domain consisting of multiple different domain types. Notch signaling is an evolutionarily conserved intercellular signaling pathway that regulates interactions between physically adjacent cells through binding of Notch family receptors to their cognate ligands. The encoded preproprotein is proteolytically processed in the trans-Golgi network to generate two polypeptide chains that heterodimerize to form the mature cell-surface receptor. This receptor plays a role in the development of numerous cell and tissue types. Mutations in this gene are associated with aortic valve disease, Adams-Oliver syndrome, T-cell acute lymphoblastic leukemia, chronic lymphocytic leukemia, and head and neck squamous cell carcinoma. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygotes for null alleles exhibit defects in embryonic development resulting in lethality at some point in organogenesis. Lethal phenotype may be affected by genetic background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik C T 11: 58,422,804 A86V possibly damaging Het
9430097D07Rik A G 2: 32,574,428 probably benign Het
Actr5 T A 2: 158,635,363 D411E probably benign Het
Ang5 A G 14: 43,962,845 D122G probably benign Het
Atg9a A T 1: 75,186,060 probably null Het
C530008M17Rik G C 5: 76,657,834 probably benign Het
Dctd C T 8: 48,137,414 probably benign Het
Ddx11 G A 17: 66,147,722 V642M possibly damaging Het
Dis3l2 G A 1: 86,760,321 V100I probably benign Het
Echdc2 T C 4: 108,172,131 V111A probably benign Het
Egr1 A G 18: 34,863,658 T498A probably benign Het
Exosc3 T C 4: 45,317,702 K200R possibly damaging Het
Exosc8 T C 3: 54,729,223 D229G probably benign Het
Ext1 T A 15: 53,092,412 I430F probably damaging Het
Fbxw22 T C 9: 109,403,424 N31S probably benign Het
Gja8 T C 3: 96,919,849 T166A probably benign Het
Gm21814 T A 6: 149,583,618 noncoding transcript Het
Gm21915 T A 9: 40,670,648 H12Q probably benign Het
Gm597 A G 1: 28,777,862 I363T possibly damaging Het
Hgsnat G A 8: 25,947,960 R527* probably null Het
Iqgap2 A G 13: 95,673,743 F731S probably benign Het
Jchain T C 5: 88,522,505 H85R probably damaging Het
Kcnb2 T C 1: 15,312,962 C171R probably benign Het
Kcnk3 C A 5: 30,622,805 R400S possibly damaging Het
Klhl28 C T 12: 64,957,227 E171K probably damaging Het
Lrrfip2 T C 9: 111,223,972 I375T possibly damaging Het
Mccc1 T C 3: 35,979,017 N326S probably benign Het
Med13l T C 5: 118,593,550 V97A possibly damaging Het
Mertk C A 2: 128,784,000 T685K probably benign Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Myom2 G A 8: 15,083,310 V401M probably damaging Het
Nme5 A C 18: 34,578,685 M1R probably null Het
Nop2 T C 6: 125,133,763 S68P probably benign Het
Olfr292 T C 7: 86,694,585 I43T possibly damaging Het
Ppat C T 5: 76,928,678 probably benign Het
Prss23 T A 7: 89,510,214 M216L probably benign Het
Psg18 A T 7: 18,349,354 V171D probably damaging Het
Psg28 A G 7: 18,427,891 V229A probably damaging Het
Qser1 T C 2: 104,787,831 N879D possibly damaging Het
Rpap1 T C 2: 119,770,041 N879S probably benign Het
Rusc2 T C 4: 43,415,926 S411P probably damaging Het
Rxfp2 T A 5: 150,067,360 W519R probably damaging Het
Scpep1 T A 11: 88,941,349 Q185L probably benign Het
Serpinb11 A G 1: 107,379,649 N270S probably benign Het
Serpinb6d T A 13: 33,671,444 M367K probably benign Het
Skint10 T G 4: 112,727,672 I213L probably benign Het
Skint5 T C 4: 113,546,537 T1163A unknown Het
Slamf9 A T 1: 172,476,213 I42L possibly damaging Het
Slc1a3 T C 15: 8,650,846 probably benign Het
Smad6 T A 9: 63,953,900 Q371L possibly damaging Het
Snx31 A T 15: 36,555,324 V26E probably damaging Het
Taf4b A G 18: 14,822,172 N594S possibly damaging Het
Tanc2 T C 11: 105,780,092 S172P probably damaging Het
Tas2r110 T A 6: 132,868,475 Y156* probably null Het
Tbc1d20 G A 2: 152,293,936 probably benign Het
Timm50 A T 7: 28,306,859 D272E probably benign Het
Ttn T G 2: 76,900,511 probably benign Het
Vps13c T A 9: 67,916,379 F1362I probably benign Het
Vwf T C 6: 125,566,257 S154P probably benign Het
Zfp445 T C 9: 122,852,345 R844G probably benign Het
Other mutations in Notch1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Notch1 APN 2 26460046 missense probably damaging 0.98
IGL01343:Notch1 APN 2 26472905 missense probably benign 0.25
IGL02066:Notch1 APN 2 26460396 missense possibly damaging 0.71
IGL02158:Notch1 APN 2 26460339 missense probably damaging 1.00
IGL02541:Notch1 APN 2 26468503 missense probably benign 0.12
IGL03280:Notch1 APN 2 26477874 intron probably benign
IGL03338:Notch1 APN 2 26459959 missense probably benign
Antero UTSW 2 26476114 missense possibly damaging 0.96
march UTSW 2 26469899 missense probably damaging 0.98
PIT4494001:Notch1 UTSW 2 26466473 missense probably damaging 1.00
R0013:Notch1 UTSW 2 26473818 missense possibly damaging 0.64
R0025:Notch1 UTSW 2 26470931 missense probably damaging 1.00
R0129:Notch1 UTSW 2 26460458 missense probably benign 0.06
R0285:Notch1 UTSW 2 26460861 missense possibly damaging 0.88
R0531:Notch1 UTSW 2 26466572 missense probably benign 0.00
R0747:Notch1 UTSW 2 26472140 missense unknown
R1440:Notch1 UTSW 2 26480964 intron probably benign
R1502:Notch1 UTSW 2 26484323 missense possibly damaging 0.95
R1539:Notch1 UTSW 2 26472113 nonsense probably null
R1623:Notch1 UTSW 2 26478612 missense possibly damaging 0.88
R1844:Notch1 UTSW 2 26460434 missense probably benign 0.12
R1863:Notch1 UTSW 2 26469950 missense probably damaging 1.00
R1874:Notch1 UTSW 2 26481579 missense possibly damaging 0.89
R1926:Notch1 UTSW 2 26481657 missense probably damaging 1.00
R2156:Notch1 UTSW 2 26460861 missense possibly damaging 0.91
R2196:Notch1 UTSW 2 26463804 nonsense probably null
R2209:Notch1 UTSW 2 26460007 missense probably benign
R2382:Notch1 UTSW 2 26473781 missense probably benign 0.40
R2508:Notch1 UTSW 2 26465473 missense possibly damaging 0.80
R2873:Notch1 UTSW 2 26460235 missense possibly damaging 0.89
R2874:Notch1 UTSW 2 26460235 missense possibly damaging 0.89
R3798:Notch1 UTSW 2 26478618 missense probably benign 0.00
R4019:Notch1 UTSW 2 26481142 missense probably benign 0.03
R4305:Notch1 UTSW 2 26477924 missense probably damaging 1.00
R4334:Notch1 UTSW 2 26460036 missense probably benign 0.22
R4504:Notch1 UTSW 2 26472177 missense probably benign 0.16
R4624:Notch1 UTSW 2 26478081 missense possibly damaging 0.94
R4659:Notch1 UTSW 2 26470889 missense probably damaging 0.99
R4703:Notch1 UTSW 2 26471158 missense probably benign
R4869:Notch1 UTSW 2 26471179 missense probably benign 0.21
R4938:Notch1 UTSW 2 26474124 nonsense probably null
R4989:Notch1 UTSW 2 26481181 missense probably damaging 1.00
R5283:Notch1 UTSW 2 26468626 missense probably damaging 1.00
R5303:Notch1 UTSW 2 26478619 missense probably benign 0.01
R5635:Notch1 UTSW 2 26476161 missense probably damaging 1.00
R5755:Notch1 UTSW 2 26473692 missense probably benign 0.12
R5926:Notch1 UTSW 2 26476104 missense probably benign 0.35
R5947:Notch1 UTSW 2 26462528 intron probably benign
R6053:Notch1 UTSW 2 26472912 missense probably benign 0.06
R6161:Notch1 UTSW 2 26468731 missense probably damaging 1.00
R6162:Notch1 UTSW 2 26462195 missense probably benign
R6174:Notch1 UTSW 2 26485442 missense possibly damaging 0.50
R6199:Notch1 UTSW 2 26469899 missense probably damaging 0.98
R6209:Notch1 UTSW 2 26472805 missense probably damaging 1.00
R6251:Notch1 UTSW 2 26474170 missense possibly damaging 0.64
R6493:Notch1 UTSW 2 26472098 missense unknown
R6723:Notch1 UTSW 2 26478106 missense probably damaging 1.00
R6736:Notch1 UTSW 2 26460286 missense probably benign 0.01
R7020:Notch1 UTSW 2 26481574 missense possibly damaging 0.95
R7058:Notch1 UTSW 2 26463818 missense probably benign 0.05
R7154:Notch1 UTSW 2 26459938 missense probably benign
R7291:Notch1 UTSW 2 26476375 missense probably benign 0.01
R7379:Notch1 UTSW 2 26479467 missense probably damaging 1.00
R7560:Notch1 UTSW 2 26460165 missense probably benign 0.43
R7610:Notch1 UTSW 2 26478179 missense probably benign 0.13
R7833:Notch1 UTSW 2 26459533 makesense probably null
R7988:Notch1 UTSW 2 26471001 missense probably benign 0.00
X0018:Notch1 UTSW 2 26462227 nonsense probably null
X0066:Notch1 UTSW 2 26470335 missense possibly damaging 0.90
Z1088:Notch1 UTSW 2 26477115 missense probably damaging 0.99
Z1177:Notch1 UTSW 2 26460309 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- GTTTGCCCATCTGGTGACTATC -3'
(R):5'- AGCTAGCATTTCTCAGGCAG -3'

Sequencing Primer
(F):5'- ATCTGGTGACTATCCCCAGG -3'
(R):5'- CAGGCAGAGATCCTAGTTCTCTTGAG -3'
Posted On2016-06-06