Incidental Mutation 'R5010:9430097D07Rik'
ID390411
Institutional Source Beutler Lab
Gene Symbol 9430097D07Rik
Ensembl Gene ENSMUSG00000075405
Gene NameRIKEN cDNA 9430097D07 gene
Synonyms
MMRRC Submission 042601-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R5010 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location32574184-32575684 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 32574428 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028151] [ENSMUST00000048375] [ENSMUST00000055304] [ENSMUST00000100188] [ENSMUST00000100190] [ENSMUST00000140592]
Predicted Effect probably benign
Transcript: ENSMUST00000028151
SMART Domains Protein: ENSMUSP00000028151
Gene: ENSMUSG00000026810

DomainStartEndE-ValueType
Pfam:DPM2 5 80 4.2e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000048375
SMART Domains Protein: ENSMUSP00000044731
Gene: ENSMUSG00000039157

DomainStartEndE-ValueType
Pfam:NT-C2 6 152 4.8e-32 PFAM
low complexity region 177 194 N/A INTRINSIC
low complexity region 262 273 N/A INTRINSIC
low complexity region 283 309 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000055304
SMART Domains Protein: ENSMUSP00000051282
Gene: ENSMUSG00000046854

DomainStartEndE-ValueType
Pfam:PIP5K 127 393 4.2e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100188
SMART Domains Protein: ENSMUSP00000097763
Gene: ENSMUSG00000046854

DomainStartEndE-ValueType
Pfam:PIP5K 165 358 4.3e-49 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000100190
AA Change: Y120H
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128039
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134204
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136816
Predicted Effect probably benign
Transcript: ENSMUST00000140592
SMART Domains Protein: ENSMUSP00000124665
Gene: ENSMUSG00000026810

DomainStartEndE-ValueType
Pfam:DPM2 5 68 3e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150419
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 98% (65/66)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik C T 11: 58,422,804 A86V possibly damaging Het
Actr5 T A 2: 158,635,363 D411E probably benign Het
Ang5 A G 14: 43,962,845 D122G probably benign Het
Atg9a A T 1: 75,186,060 probably null Het
C530008M17Rik G C 5: 76,657,834 probably benign Het
Dctd C T 8: 48,137,414 probably benign Het
Ddx11 G A 17: 66,147,722 V642M possibly damaging Het
Dis3l2 G A 1: 86,760,321 V100I probably benign Het
Echdc2 T C 4: 108,172,131 V111A probably benign Het
Egr1 A G 18: 34,863,658 T498A probably benign Het
Exosc3 T C 4: 45,317,702 K200R possibly damaging Het
Exosc8 T C 3: 54,729,223 D229G probably benign Het
Ext1 T A 15: 53,092,412 I430F probably damaging Het
Fbxw22 T C 9: 109,403,424 N31S probably benign Het
Gja8 T C 3: 96,919,849 T166A probably benign Het
Gm21814 T A 6: 149,583,618 noncoding transcript Het
Gm21915 T A 9: 40,670,648 H12Q probably benign Het
Gm597 A G 1: 28,777,862 I363T possibly damaging Het
Hgsnat G A 8: 25,947,960 R527* probably null Het
Iqgap2 A G 13: 95,673,743 F731S probably benign Het
Jchain T C 5: 88,522,505 H85R probably damaging Het
Kcnb2 T C 1: 15,312,962 C171R probably benign Het
Kcnk3 C A 5: 30,622,805 R400S possibly damaging Het
Klhl28 C T 12: 64,957,227 E171K probably damaging Het
Lrrfip2 T C 9: 111,223,972 I375T possibly damaging Het
Mccc1 T C 3: 35,979,017 N326S probably benign Het
Med13l T C 5: 118,593,550 V97A possibly damaging Het
Mertk C A 2: 128,784,000 T685K probably benign Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Myom2 G A 8: 15,083,310 V401M probably damaging Het
Nme5 A C 18: 34,578,685 M1R probably null Het
Nop2 T C 6: 125,133,763 S68P probably benign Het
Notch1 A T 2: 26,476,114 D809E possibly damaging Het
Olfr292 T C 7: 86,694,585 I43T possibly damaging Het
Ppat C T 5: 76,928,678 probably benign Het
Prss23 T A 7: 89,510,214 M216L probably benign Het
Psg18 A T 7: 18,349,354 V171D probably damaging Het
Psg28 A G 7: 18,427,891 V229A probably damaging Het
Qser1 T C 2: 104,787,831 N879D possibly damaging Het
Rpap1 T C 2: 119,770,041 N879S probably benign Het
Rusc2 T C 4: 43,415,926 S411P probably damaging Het
Rxfp2 T A 5: 150,067,360 W519R probably damaging Het
Scpep1 T A 11: 88,941,349 Q185L probably benign Het
Serpinb11 A G 1: 107,379,649 N270S probably benign Het
Serpinb6d T A 13: 33,671,444 M367K probably benign Het
Skint10 T G 4: 112,727,672 I213L probably benign Het
Skint5 T C 4: 113,546,537 T1163A unknown Het
Slamf9 A T 1: 172,476,213 I42L possibly damaging Het
Slc1a3 T C 15: 8,650,846 probably benign Het
Smad6 T A 9: 63,953,900 Q371L possibly damaging Het
Snx31 A T 15: 36,555,324 V26E probably damaging Het
Taf4b A G 18: 14,822,172 N594S possibly damaging Het
Tanc2 T C 11: 105,780,092 S172P probably damaging Het
Tas2r110 T A 6: 132,868,475 Y156* probably null Het
Tbc1d20 G A 2: 152,293,936 probably benign Het
Timm50 A T 7: 28,306,859 D272E probably benign Het
Ttn T G 2: 76,900,511 probably benign Het
Vps13c T A 9: 67,916,379 F1362I probably benign Het
Vwf T C 6: 125,566,257 S154P probably benign Het
Zfp445 T C 9: 122,852,345 R844G probably benign Het
Other mutations in 9430097D07Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02214:9430097D07Rik APN 2 32574724 unclassified probably benign
R0356:9430097D07Rik UTSW 2 32574406 unclassified probably benign
R1776:9430097D07Rik UTSW 2 32574755 unclassified probably benign
R4525:9430097D07Rik UTSW 2 32574376 unclassified probably benign
R4886:9430097D07Rik UTSW 2 32574618 unclassified probably benign
R5613:9430097D07Rik UTSW 2 32575334 unclassified probably benign
R7059:9430097D07Rik UTSW 2 32574497 unclassified probably benign
R7919:9430097D07Rik UTSW 2 32574449 missense unknown
R7977:9430097D07Rik UTSW 2 32574305 missense unknown
R7987:9430097D07Rik UTSW 2 32574305 missense unknown
Predicted Primers PCR Primer
(F):5'- GGTTCCTTCATCCTGATGGC -3'
(R):5'- ACAAACTTGGGAACTGTGTGG -3'

Sequencing Primer
(F):5'- AATCCCGGCATTCAGGATTTG -3'
(R):5'- CAAACTTGGGAACTGTGTGGATTGG -3'
Posted On2016-06-06