Incidental Mutation 'R5010:Rpap1'
ID390414
Institutional Source Beutler Lab
Gene Symbol Rpap1
Ensembl Gene ENSMUSG00000034032
Gene NameRNA polymerase II associated protein 1
Synonyms
MMRRC Submission 042601-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R5010 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location119763304-119787537 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119770041 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 879 (N879S)
Ref Sequence ENSEMBL: ENSMUSP00000106420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048493] [ENSMUST00000099529] [ENSMUST00000110793] [ENSMUST00000136419] [ENSMUST00000184294]
Predicted Effect probably benign
Transcript: ENSMUST00000048493
AA Change: N879S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000037275
Gene: ENSMUSG00000034032
AA Change: N879S

DomainStartEndE-ValueType
low complexity region 62 81 N/A INTRINSIC
Pfam:RPAP1_N 225 270 2.4e-21 PFAM
Pfam:RPAP1_C 372 438 1.9e-27 PFAM
low complexity region 451 473 N/A INTRINSIC
low complexity region 476 488 N/A INTRINSIC
low complexity region 515 529 N/A INTRINSIC
low complexity region 739 752 N/A INTRINSIC
low complexity region 843 860 N/A INTRINSIC
low complexity region 989 1007 N/A INTRINSIC
low complexity region 1042 1052 N/A INTRINSIC
low complexity region 1097 1108 N/A INTRINSIC
low complexity region 1193 1204 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099529
AA Change: N879S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097127
Gene: ENSMUSG00000034032
AA Change: N879S

DomainStartEndE-ValueType
low complexity region 62 81 N/A INTRINSIC
Pfam:RPAP1_N 224 272 1.7e-21 PFAM
Pfam:RPAP1_C 370 440 2.9e-27 PFAM
low complexity region 451 473 N/A INTRINSIC
low complexity region 476 488 N/A INTRINSIC
low complexity region 515 529 N/A INTRINSIC
low complexity region 739 752 N/A INTRINSIC
low complexity region 843 860 N/A INTRINSIC
low complexity region 989 1007 N/A INTRINSIC
low complexity region 1042 1052 N/A INTRINSIC
low complexity region 1097 1108 N/A INTRINSIC
low complexity region 1193 1204 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110793
AA Change: N879S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106420
Gene: ENSMUSG00000034032
AA Change: N879S

DomainStartEndE-ValueType
low complexity region 62 81 N/A INTRINSIC
Pfam:RPAP1_N 224 272 1.7e-21 PFAM
Pfam:RPAP1_C 370 440 2.9e-27 PFAM
low complexity region 451 473 N/A INTRINSIC
low complexity region 476 488 N/A INTRINSIC
low complexity region 515 529 N/A INTRINSIC
low complexity region 739 752 N/A INTRINSIC
low complexity region 843 860 N/A INTRINSIC
low complexity region 989 1007 N/A INTRINSIC
low complexity region 1042 1052 N/A INTRINSIC
low complexity region 1097 1108 N/A INTRINSIC
low complexity region 1193 1204 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136419
SMART Domains Protein: ENSMUSP00000138619
Gene: ENSMUSG00000034032

DomainStartEndE-ValueType
low complexity region 62 81 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139311
Predicted Effect probably benign
Transcript: ENSMUST00000184294
SMART Domains Protein: ENSMUSP00000138873
Gene: ENSMUSG00000034032

DomainStartEndE-ValueType
low complexity region 62 81 N/A INTRINSIC
Pfam:RPAP1_N 224 272 4.8e-22 PFAM
Pfam:RPAP1_C 370 440 1.2e-27 PFAM
low complexity region 451 473 N/A INTRINSIC
low complexity region 476 488 N/A INTRINSIC
low complexity region 515 529 N/A INTRINSIC
low complexity region 739 752 N/A INTRINSIC
low complexity region 843 860 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein forms part of the RNA polymerase II (RNAPII) enzyme complex and may recruit RNAPII to chromatin through its interaction with acetylated histones. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik C T 11: 58,422,804 A86V possibly damaging Het
9430097D07Rik A G 2: 32,574,428 probably benign Het
Actr5 T A 2: 158,635,363 D411E probably benign Het
Ang5 A G 14: 43,962,845 D122G probably benign Het
Atg9a A T 1: 75,186,060 probably null Het
C530008M17Rik G C 5: 76,657,834 probably benign Het
Dctd C T 8: 48,137,414 probably benign Het
Ddx11 G A 17: 66,147,722 V642M possibly damaging Het
Dis3l2 G A 1: 86,760,321 V100I probably benign Het
Echdc2 T C 4: 108,172,131 V111A probably benign Het
Egr1 A G 18: 34,863,658 T498A probably benign Het
Exosc3 T C 4: 45,317,702 K200R possibly damaging Het
Exosc8 T C 3: 54,729,223 D229G probably benign Het
Ext1 T A 15: 53,092,412 I430F probably damaging Het
Fbxw22 T C 9: 109,403,424 N31S probably benign Het
Gja8 T C 3: 96,919,849 T166A probably benign Het
Gm21814 T A 6: 149,583,618 noncoding transcript Het
Gm21915 T A 9: 40,670,648 H12Q probably benign Het
Gm597 A G 1: 28,777,862 I363T possibly damaging Het
Hgsnat G A 8: 25,947,960 R527* probably null Het
Iqgap2 A G 13: 95,673,743 F731S probably benign Het
Jchain T C 5: 88,522,505 H85R probably damaging Het
Kcnb2 T C 1: 15,312,962 C171R probably benign Het
Kcnk3 C A 5: 30,622,805 R400S possibly damaging Het
Klhl28 C T 12: 64,957,227 E171K probably damaging Het
Lrrfip2 T C 9: 111,223,972 I375T possibly damaging Het
Mccc1 T C 3: 35,979,017 N326S probably benign Het
Med13l T C 5: 118,593,550 V97A possibly damaging Het
Mertk C A 2: 128,784,000 T685K probably benign Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Myom2 G A 8: 15,083,310 V401M probably damaging Het
Nme5 A C 18: 34,578,685 M1R probably null Het
Nop2 T C 6: 125,133,763 S68P probably benign Het
Notch1 A T 2: 26,476,114 D809E possibly damaging Het
Olfr292 T C 7: 86,694,585 I43T possibly damaging Het
Ppat C T 5: 76,928,678 probably benign Het
Prss23 T A 7: 89,510,214 M216L probably benign Het
Psg18 A T 7: 18,349,354 V171D probably damaging Het
Psg28 A G 7: 18,427,891 V229A probably damaging Het
Qser1 T C 2: 104,787,831 N879D possibly damaging Het
Rusc2 T C 4: 43,415,926 S411P probably damaging Het
Rxfp2 T A 5: 150,067,360 W519R probably damaging Het
Scpep1 T A 11: 88,941,349 Q185L probably benign Het
Serpinb11 A G 1: 107,379,649 N270S probably benign Het
Serpinb6d T A 13: 33,671,444 M367K probably benign Het
Skint10 T G 4: 112,727,672 I213L probably benign Het
Skint5 T C 4: 113,546,537 T1163A unknown Het
Slamf9 A T 1: 172,476,213 I42L possibly damaging Het
Slc1a3 T C 15: 8,650,846 probably benign Het
Smad6 T A 9: 63,953,900 Q371L possibly damaging Het
Snx31 A T 15: 36,555,324 V26E probably damaging Het
Taf4b A G 18: 14,822,172 N594S possibly damaging Het
Tanc2 T C 11: 105,780,092 S172P probably damaging Het
Tas2r110 T A 6: 132,868,475 Y156* probably null Het
Tbc1d20 G A 2: 152,293,936 probably benign Het
Timm50 A T 7: 28,306,859 D272E probably benign Het
Ttn T G 2: 76,900,511 probably benign Het
Vps13c T A 9: 67,916,379 F1362I probably benign Het
Vwf T C 6: 125,566,257 S154P probably benign Het
Zfp445 T C 9: 122,852,345 R844G probably benign Het
Other mutations in Rpap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01807:Rpap1 APN 2 119782708 missense possibly damaging 0.50
IGL02009:Rpap1 APN 2 119780113 missense possibly damaging 0.51
IGL02068:Rpap1 APN 2 119782654 missense probably benign 0.02
IGL02100:Rpap1 APN 2 119769326 missense probably benign 0.06
IGL02528:Rpap1 APN 2 119774950 splice site probably null
IGL02530:Rpap1 APN 2 119783239 splice site probably benign
IGL02747:Rpap1 APN 2 119774128 missense probably damaging 0.98
IGL03371:Rpap1 APN 2 119775057 splice site probably benign
R0138:Rpap1 UTSW 2 119764899 splice site probably null
R0325:Rpap1 UTSW 2 119771840 missense probably benign
R0616:Rpap1 UTSW 2 119778120 missense probably damaging 1.00
R1081:Rpap1 UTSW 2 119771269 missense probably damaging 1.00
R1657:Rpap1 UTSW 2 119783778 missense possibly damaging 0.53
R1837:Rpap1 UTSW 2 119769885 critical splice donor site probably null
R2307:Rpap1 UTSW 2 119783766 missense probably benign 0.00
R2308:Rpap1 UTSW 2 119783766 missense probably benign 0.00
R2375:Rpap1 UTSW 2 119770407 missense possibly damaging 0.50
R2507:Rpap1 UTSW 2 119780054 critical splice donor site probably null
R2508:Rpap1 UTSW 2 119780054 critical splice donor site probably null
R4155:Rpap1 UTSW 2 119774179 missense probably damaging 1.00
R4156:Rpap1 UTSW 2 119774179 missense probably damaging 1.00
R4157:Rpap1 UTSW 2 119774179 missense probably damaging 1.00
R4657:Rpap1 UTSW 2 119775006 missense probably benign 0.03
R4837:Rpap1 UTSW 2 119778251 missense probably benign 0.32
R4880:Rpap1 UTSW 2 119783865 missense probably damaging 0.97
R5111:Rpap1 UTSW 2 119771247 missense probably damaging 1.00
R5650:Rpap1 UTSW 2 119773850 missense probably benign
R6144:Rpap1 UTSW 2 119772647 nonsense probably null
R6353:Rpap1 UTSW 2 119776896 splice site probably null
R6646:Rpap1 UTSW 2 119780131 missense probably benign 0.03
R6731:Rpap1 UTSW 2 119778296 missense probably benign
R6872:Rpap1 UTSW 2 119775369 missense probably damaging 1.00
R6878:Rpap1 UTSW 2 119778176 missense probably damaging 1.00
R7060:Rpap1 UTSW 2 119773562 missense probably damaging 1.00
R7558:Rpap1 UTSW 2 119771254 missense probably benign
R7640:Rpap1 UTSW 2 119764410 missense possibly damaging 0.63
R7862:Rpap1 UTSW 2 119775412 critical splice acceptor site probably null
R8055:Rpap1 UTSW 2 119764803 missense probably benign 0.13
X0028:Rpap1 UTSW 2 119771062 missense probably benign
Z1177:Rpap1 UTSW 2 119783752 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGATGGGTTCTGGGACTC -3'
(R):5'- GCCTGAGGAAACCCAAATTTC -3'

Sequencing Primer
(F):5'- ATGCCTGGCCTCCAAATG -3'
(R):5'- TTTCCAGCAGGAGCAACC -3'
Posted On2016-06-06