Mutagenetix > Incidental Mutation

Incidental Mutation 'R5010:Mertk'

390415

Institutional Source

Beutler Lab

Gene Symbol

Mertk

Ensembl Gene

ENSMUSG00000014361

Gene Name

c-mer proto-oncogene tyrosine kinase

Synonyms

Nyk, nmf12, Tyro 12, Eyk, Mer

MMRRC Submission

042601-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.144) question?

Stock #

R5010 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

128698956-128802894 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 128784000 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 685 (T685K)

Ref Sequence

ENSEMBL: ENSMUSP00000014505 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014505]

AlphaFold

Q60805

Predicted Effect

probably benign
Transcript: ENSMUST00000014505
AA Change: T685K

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000014505
Gene: ENSMUSG00000014361
AA Change: T685K

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
IG	94	189	8.99e-6	SMART
IG	198	276	1.54e-4	SMART
FN3	279	363	7.23e-8	SMART
FN3	379	465	6.16e-2	SMART
transmembrane domain	498	520	N/A	INTRINSIC
TyrKc	582	849	2.88e-129	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140221

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000157160

Meta Mutation Damage Score

0.1655

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.6%

Validation Efficiency

98% (65/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the MER/AXL/TYRO3 receptor kinase family and encodes a transmembrane protein with two fibronectin type-III domains, two Ig-like C2-type (immunoglobulin-like) domains, and one tyrosine kinase domain. Mutations in this gene have been associated with disruption of the retinal pigment epithelium (RPE) phagocytosis pathway and onset of autosomal recessive retinitis pigmentosa (RP). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations show increased sensitivity to LPS-induced shock, defective phagocytosis of apoptotic cells, lupus-like autoimmunity, degeneration of photoreceptors, decreased platelet aggregation and protection from induced pulmonary thromboembolism and thrombosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810065E05Rik	C	T	11: 58,422,804	A86V	possibly damaging	Het
9430097D07Rik	A	G	2: 32,574,428		probably benign	Het
Actr5	T	A	2: 158,635,363	D411E	probably benign	Het
Ang5	A	G	14: 43,962,845	D122G	probably benign	Het
Atg9a	A	T	1: 75,186,060		probably null	Het
C530008M17Rik	G	C	5: 76,657,834		probably benign	Het
Dctd	C	T	8: 48,137,414		probably benign	Het
Ddx11	G	A	17: 66,147,722	V642M	possibly damaging	Het
Dis3l2	G	A	1: 86,760,321	V100I	probably benign	Het
Echdc2	T	C	4: 108,172,131	V111A	probably benign	Het
Egr1	A	G	18: 34,863,658	T498A	probably benign	Het
Exosc3	T	C	4: 45,317,702	K200R	possibly damaging	Het
Exosc8	T	C	3: 54,729,223	D229G	probably benign	Het
Ext1	T	A	15: 53,092,412	I430F	probably damaging	Het
Fbxw22	T	C	9: 109,403,424	N31S	probably benign	Het
Gja8	T	C	3: 96,919,849	T166A	probably benign	Het
Gm21814	T	A	6: 149,583,618		noncoding transcript	Het
Gm21915	T	A	9: 40,670,648	H12Q	probably benign	Het
Gm597	A	G	1: 28,777,862	I363T	possibly damaging	Het
Hgsnat	G	A	8: 25,947,960	R527*	probably null	Het
Iqgap2	A	G	13: 95,673,743	F731S	probably benign	Het
Jchain	T	C	5: 88,522,505	H85R	probably damaging	Het
Kcnb2	T	C	1: 15,312,962	C171R	probably benign	Het
Kcnk3	C	A	5: 30,622,805	R400S	possibly damaging	Het
Klhl28	C	T	12: 64,957,227	E171K	probably damaging	Het
Lrrfip2	T	C	9: 111,223,972	I375T	possibly damaging	Het
Mccc1	T	C	3: 35,979,017	N326S	probably benign	Het
Med13l	T	C	5: 118,593,550	V97A	possibly damaging	Het
Msh2	C	A	17: 87,723,413	A906E	probably benign	Het
Myom2	G	A	8: 15,083,310	V401M	probably damaging	Het
Nme5	A	C	18: 34,578,685	M1R	probably null	Het
Nop2	T	C	6: 125,133,763	S68P	probably benign	Het
Notch1	A	T	2: 26,476,114	D809E	possibly damaging	Het
Olfr292	T	C	7: 86,694,585	I43T	possibly damaging	Het
Ppat	C	T	5: 76,928,678		probably benign	Het
Prss23	T	A	7: 89,510,214	M216L	probably benign	Het
Psg18	A	T	7: 18,349,354	V171D	probably damaging	Het
Psg28	A	G	7: 18,427,891	V229A	probably damaging	Het
Qser1	T	C	2: 104,787,831	N879D	possibly damaging	Het
Rpap1	T	C	2: 119,770,041	N879S	probably benign	Het
Rusc2	T	C	4: 43,415,926	S411P	probably damaging	Het
Rxfp2	T	A	5: 150,067,360	W519R	probably damaging	Het
Scpep1	T	A	11: 88,941,349	Q185L	probably benign	Het
Serpinb11	A	G	1: 107,379,649	N270S	probably benign	Het
Serpinb6d	T	A	13: 33,671,444	M367K	probably benign	Het
Skint10	T	G	4: 112,727,672	I213L	probably benign	Het
Skint5	T	C	4: 113,546,537	T1163A	unknown	Het
Slamf9	A	T	1: 172,476,213	I42L	possibly damaging	Het
Slc1a3	T	C	15: 8,650,846		probably benign	Het
Smad6	T	A	9: 63,953,900	Q371L	possibly damaging	Het
Snx31	A	T	15: 36,555,324	V26E	probably damaging	Het
Taf4b	A	G	18: 14,822,172	N594S	possibly damaging	Het
Tanc2	T	C	11: 105,780,092	S172P	probably damaging	Het
Tas2r110	T	A	6: 132,868,475	Y156*	probably null	Het
Tbc1d20	G	A	2: 152,293,936		probably benign	Het
Timm50	A	T	7: 28,306,859	D272E	probably benign	Het
Ttn	T	G	2: 76,900,511		probably benign	Het
Vps13c	T	A	9: 67,916,379	F1362I	probably benign	Het
Vwf	T	C	6: 125,566,257	S154P	probably benign	Het
Zfp445	T	C	9: 122,852,345	R844G	probably benign	Het

Other mutations in Mertk

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01540:Mertk	APN	2	128783967	missense	probably damaging	1.00
IGL01561:Mertk	APN	2	128736636	missense	probably damaging	1.00
IGL01873:Mertk	APN	2	128729275	missense	possibly damaging	0.93
IGL02539:Mertk	APN	2	128801290	missense	probably damaging	1.00
IGL02652:Mertk	APN	2	128801270	missense	probably benign
IGL02962:Mertk	APN	2	128777454	missense	probably damaging	1.00
IGL03237:Mertk	APN	2	128790272	missense	probably damaging	1.00
PIT4378001:Mertk	UTSW	2	128782617	critical splice donor site	probably null
R0118:Mertk	UTSW	2	128759166	missense	probably damaging	0.99
R0281:Mertk	UTSW	2	128782621	splice site	probably benign
R0491:Mertk	UTSW	2	128793107	critical splice donor site	probably null
R0565:Mertk	UTSW	2	128771483	missense	probably benign	0.20
R0628:Mertk	UTSW	2	128738313	missense	probably damaging	1.00
R1260:Mertk	UTSW	2	128762152	missense	probably benign	0.03
R1406:Mertk	UTSW	2	128771486	missense	probably benign	0.00
R1406:Mertk	UTSW	2	128771486	missense	probably benign	0.00
R1423:Mertk	UTSW	2	128778963	missense	probably damaging	1.00
R1523:Mertk	UTSW	2	128790328	critical splice donor site	probably null
R1539:Mertk	UTSW	2	128782526	missense	probably benign	0.05
R1680:Mertk	UTSW	2	128801636	missense	probably benign	0.03
R1770:Mertk	UTSW	2	128750174	missense	probably benign	0.10
R1832:Mertk	UTSW	2	128762212	missense	probably benign	0.10
R1870:Mertk	UTSW	2	128801196	missense	probably benign	0.01
R1959:Mertk	UTSW	2	128759090	missense	probably damaging	0.98
R2078:Mertk	UTSW	2	128794458	missense	probably damaging	1.00
R2125:Mertk	UTSW	2	128762138	missense	probably benign
R2178:Mertk	UTSW	2	128793064	missense	probably damaging	1.00
R2220:Mertk	UTSW	2	128801472	missense	probably benign	0.18
R4128:Mertk	UTSW	2	128777438	nonsense	probably null
R4664:Mertk	UTSW	2	128801212	missense	probably benign	0.24
R4740:Mertk	UTSW	2	128751994	missense	probably damaging	1.00
R4822:Mertk	UTSW	2	128801305	missense	probably benign	0.00
R4839:Mertk	UTSW	2	128782576	missense	probably damaging	0.97
R4874:Mertk	UTSW	2	128750159	missense	probably damaging	1.00
R4899:Mertk	UTSW	2	128783925	missense	probably damaging	1.00
R5128:Mertk	UTSW	2	128738247	missense	probably damaging	0.97
R5251:Mertk	UTSW	2	128729455	missense	probably damaging	1.00
R5276:Mertk	UTSW	2	128801314	missense	possibly damaging	0.87
R5397:Mertk	UTSW	2	128771464	missense	possibly damaging	0.86
R5575:Mertk	UTSW	2	128736565	missense	probably damaging	1.00
R5605:Mertk	UTSW	2	128738307	missense	probably benign	0.43
R5705:Mertk	UTSW	2	128771401	missense	probably benign	0.00
R5987:Mertk	UTSW	2	128771374	missense	probably benign	0.01
R6127:Mertk	UTSW	2	128738291	missense	probably damaging	0.99
R6556:Mertk	UTSW	2	128776421	missense	probably benign	0.23
R6671:Mertk	UTSW	2	128752023	critical splice donor site	probably null
R6674:Mertk	UTSW	2	128729357	missense	probably benign
R6841:Mertk	UTSW	2	128759230	splice site	probably null
R7153:Mertk	UTSW	2	128736649	missense	probably damaging	0.99
R7192:Mertk	UTSW	2	128793108	splice site	probably null
R7225:Mertk	UTSW	2	128801562	missense	possibly damaging	0.94
R7344:Mertk	UTSW	2	128771497	missense	probably benign
R7414:Mertk	UTSW	2	128729393	missense	possibly damaging	0.95
R7883:Mertk	UTSW	2	128776345	missense	probably benign	0.01
R8000:Mertk	UTSW	2	128771498	missense	probably benign
R8953:Mertk	UTSW	2	128778796	intron	probably benign
R9135:Mertk	UTSW	2	128762115	missense	probably benign	0.23
R9153:Mertk	UTSW	2	128782567	missense	probably damaging	1.00
R9176:Mertk	UTSW	2	128778972	missense	possibly damaging	0.62
R9443:Mertk	UTSW	2	128762109	missense	probably benign	0.00
R9574:Mertk	UTSW	2	128751960	missense	probably benign	0.03
R9582:Mertk	UTSW	2	128782607	missense	possibly damaging	0.55
R9616:Mertk	UTSW	2	128801335	missense	probably benign	0.01
X0067:Mertk	UTSW	2	128729567	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTTCAATTTGGCCAGCAG -3'
(R):5'- AAGATTATTGGAGCAGCTGGC -3'

Sequencing Primer
(F):5'- AGCAGCCTCCATATGTATTCATATC -3'
(R):5'- TTCCTCCCACCATGAGCAGG -3'

Posted On

2016-06-06