Incidental Mutation 'R5010:Mccc1'
ID 390417
Institutional Source Beutler Lab
Gene Symbol Mccc1
Ensembl Gene ENSMUSG00000027709
Gene Name methylcrotonoyl-Coenzyme A carboxylase 1 (alpha)
Synonyms 1810045E08Rik, MCCA, MCCalpha, 2310058B18Rik
MMRRC Submission 042601-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5010 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 36013461-36054827 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 36033166 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 326 (N326S)
Ref Sequence ENSEMBL: ENSMUSP00000029259 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029259] [ENSMUST00000199113] [ENSMUST00000200163]
AlphaFold Q99MR8
Predicted Effect probably benign
Transcript: ENSMUST00000029259
AA Change: N326S

PolyPhen 2 Score 0.152 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000029259
Gene: ENSMUSG00000027709
AA Change: N326S

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
Pfam:CPSase_L_chain 44 153 4.7e-50 PFAM
Pfam:ATP-grasp_4 156 337 3.7e-20 PFAM
Pfam:RimK 158 358 1e-6 PFAM
Pfam:CPSase_L_D2 159 367 2.8e-79 PFAM
Pfam:ATP-grasp_3 160 339 8.1e-9 PFAM
Pfam:Dala_Dala_lig_C 165 335 1.2e-16 PFAM
Pfam:ATP-grasp 166 337 3.7e-13 PFAM
Biotin_carb_C 379 486 7.14e-48 SMART
Pfam:Biotin_lipoyl 644 710 1.1e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196662
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198515
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198634
Predicted Effect probably benign
Transcript: ENSMUST00000199113
SMART Domains Protein: ENSMUSP00000143266
Gene: ENSMUSG00000027709

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
Pfam:CPSase_L_chain 44 153 3.5e-48 PFAM
Pfam:ATP-grasp_4 156 253 4.1e-10 PFAM
Pfam:CPSase_L_D2 159 253 1.2e-24 PFAM
Pfam:Dala_Dala_lig_C 165 254 1.6e-8 PFAM
Pfam:ATP-grasp 166 253 8.3e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200163
AA Change: N106S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000143039
Gene: ENSMUSG00000027709
AA Change: N106S

DomainStartEndE-ValueType
Pfam:Dala_Dala_lig_C 1 115 3.8e-8 PFAM
Pfam:ATP-grasp_4 1 117 1.5e-9 PFAM
Pfam:CPSase_L_D2 1 147 3.9e-59 PFAM
Pfam:Biotin_carb_C 159 200 1.5e-9 PFAM
Meta Mutation Damage Score 0.2978 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the large subunit of 3-methylcrotonyl-CoA carboxylase. This enzyme functions as a heterodimer and catalyzes the carboxylation of 3-methylcrotonyl-CoA to form 3-methylglutaconyl-CoA. Mutations in this gene are associated with 3-Methylcrotonylglycinuria, an autosomal recessive disorder of leucine catabolism. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik C T 11: 58,313,630 (GRCm39) A86V possibly damaging Het
9430097D07Rik A G 2: 32,464,440 (GRCm39) probably benign Het
Actr5 T A 2: 158,477,283 (GRCm39) D411E probably benign Het
Ang5 A G 14: 44,200,302 (GRCm39) D122G probably benign Het
Atg9a A T 1: 75,162,704 (GRCm39) probably null Het
Cracd G C 5: 76,805,681 (GRCm39) probably benign Het
Dctd C T 8: 48,590,449 (GRCm39) probably benign Het
Ddx11 G A 17: 66,454,717 (GRCm39) V642M possibly damaging Het
Dis3l2 G A 1: 86,688,043 (GRCm39) V100I probably benign Het
Echdc2 T C 4: 108,029,328 (GRCm39) V111A probably benign Het
Egr1 A G 18: 34,996,711 (GRCm39) T498A probably benign Het
Exosc3 T C 4: 45,317,702 (GRCm39) K200R possibly damaging Het
Exosc8 T C 3: 54,636,644 (GRCm39) D229G probably benign Het
Ext1 T A 15: 52,955,808 (GRCm39) I430F probably damaging Het
Fbxw22 T C 9: 109,232,492 (GRCm39) N31S probably benign Het
Gja8 T C 3: 96,827,165 (GRCm39) T166A probably benign Het
Gm21814 T A 6: 149,485,116 (GRCm39) noncoding transcript Het
Gm21915 T A 9: 40,581,944 (GRCm39) H12Q probably benign Het
Hgsnat G A 8: 26,437,988 (GRCm39) R527* probably null Het
Iqgap2 A G 13: 95,810,251 (GRCm39) F731S probably benign Het
Jchain T C 5: 88,670,364 (GRCm39) H85R probably damaging Het
Kcnb2 T C 1: 15,383,186 (GRCm39) C171R probably benign Het
Kcnk3 C A 5: 30,780,149 (GRCm39) R400S possibly damaging Het
Klhl28 C T 12: 65,004,001 (GRCm39) E171K probably damaging Het
Lrrfip2 T C 9: 111,053,040 (GRCm39) I375T possibly damaging Het
Med13l T C 5: 118,731,615 (GRCm39) V97A possibly damaging Het
Mertk C A 2: 128,625,920 (GRCm39) T685K probably benign Het
Msh2 C A 17: 88,030,841 (GRCm39) A906E probably benign Het
Myom2 G A 8: 15,133,310 (GRCm39) V401M probably damaging Het
Nme5 A C 18: 34,711,738 (GRCm39) M1R probably null Het
Nop2 T C 6: 125,110,726 (GRCm39) S68P probably benign Het
Notch1 A T 2: 26,366,126 (GRCm39) D809E possibly damaging Het
Or14c39 T C 7: 86,343,793 (GRCm39) I43T possibly damaging Het
Ppat C T 5: 77,076,525 (GRCm39) probably benign Het
Prss23 T A 7: 89,159,422 (GRCm39) M216L probably benign Het
Psg18 A T 7: 18,083,279 (GRCm39) V171D probably damaging Het
Psg28 A G 7: 18,161,816 (GRCm39) V229A probably damaging Het
Qser1 T C 2: 104,618,176 (GRCm39) N879D possibly damaging Het
Rpap1 T C 2: 119,600,522 (GRCm39) N879S probably benign Het
Rusc2 T C 4: 43,415,926 (GRCm39) S411P probably damaging Het
Rxfp2 T A 5: 149,990,825 (GRCm39) W519R probably damaging Het
Scpep1 T A 11: 88,832,175 (GRCm39) Q185L probably benign Het
Serpinb11 A G 1: 107,307,379 (GRCm39) N270S probably benign Het
Serpinb6d T A 13: 33,855,427 (GRCm39) M367K probably benign Het
Skint10 T G 4: 112,584,869 (GRCm39) I213L probably benign Het
Skint5 T C 4: 113,403,734 (GRCm39) T1163A unknown Het
Slamf9 A T 1: 172,303,780 (GRCm39) I42L possibly damaging Het
Slc1a3 T C 15: 8,680,330 (GRCm39) probably benign Het
Smad6 T A 9: 63,861,182 (GRCm39) Q371L possibly damaging Het
Snx31 A T 15: 36,555,469 (GRCm39) V26E probably damaging Het
Spata31e5 A G 1: 28,816,943 (GRCm39) I363T possibly damaging Het
Taf4b A G 18: 14,955,229 (GRCm39) N594S possibly damaging Het
Tanc2 T C 11: 105,670,918 (GRCm39) S172P probably damaging Het
Tas2r110 T A 6: 132,845,438 (GRCm39) Y156* probably null Het
Tbc1d20 G A 2: 152,135,856 (GRCm39) probably benign Het
Timm50 A T 7: 28,006,284 (GRCm39) D272E probably benign Het
Ttn T G 2: 76,730,855 (GRCm39) probably benign Het
Vps13c T A 9: 67,823,661 (GRCm39) F1362I probably benign Het
Vwf T C 6: 125,543,220 (GRCm39) S154P probably benign Het
Zfp445 T C 9: 122,681,410 (GRCm39) R844G probably benign Het
Other mutations in Mccc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01483:Mccc1 APN 3 36,044,009 (GRCm39) missense probably damaging 0.99
IGL01601:Mccc1 APN 3 36,044,101 (GRCm39) missense probably benign 0.00
IGL01671:Mccc1 APN 3 36,018,609 (GRCm39) missense probably benign
IGL01784:Mccc1 APN 3 36,030,897 (GRCm39) missense probably damaging 0.99
IGL01878:Mccc1 APN 3 36,030,041 (GRCm39) missense probably damaging 1.00
IGL02088:Mccc1 APN 3 36,028,351 (GRCm39) missense probably damaging 1.00
IGL02709:Mccc1 APN 3 36,044,888 (GRCm39) makesense probably null
IGL02932:Mccc1 APN 3 36,014,178 (GRCm39) missense possibly damaging 0.86
IGL02972:Mccc1 APN 3 36,039,238 (GRCm39) missense possibly damaging 0.58
IGL03145:Mccc1 APN 3 36,022,595 (GRCm39) missense probably benign
P0019:Mccc1 UTSW 3 36,018,544 (GRCm39) missense probably benign 0.00
R0244:Mccc1 UTSW 3 36,044,196 (GRCm39) critical splice donor site probably null
R0391:Mccc1 UTSW 3 36,017,719 (GRCm39) splice site probably benign
R1466:Mccc1 UTSW 3 36,028,435 (GRCm39) missense probably benign 0.01
R1466:Mccc1 UTSW 3 36,028,435 (GRCm39) missense probably benign 0.01
R1591:Mccc1 UTSW 3 36,044,006 (GRCm39) missense probably damaging 1.00
R1663:Mccc1 UTSW 3 36,033,082 (GRCm39) missense probably damaging 1.00
R1827:Mccc1 UTSW 3 36,039,150 (GRCm39) missense probably damaging 1.00
R3800:Mccc1 UTSW 3 36,054,658 (GRCm39) missense probably damaging 1.00
R4290:Mccc1 UTSW 3 36,044,217 (GRCm39) missense probably damaging 0.98
R4291:Mccc1 UTSW 3 36,044,217 (GRCm39) missense probably damaging 0.98
R4707:Mccc1 UTSW 3 36,030,022 (GRCm39) missense probably damaging 0.99
R4757:Mccc1 UTSW 3 36,050,066 (GRCm39) missense probably benign 0.32
R4783:Mccc1 UTSW 3 36,030,022 (GRCm39) missense probably damaging 0.99
R4785:Mccc1 UTSW 3 36,030,022 (GRCm39) missense probably damaging 0.99
R4798:Mccc1 UTSW 3 36,039,150 (GRCm39) missense probably damaging 0.99
R4807:Mccc1 UTSW 3 36,039,195 (GRCm39) missense probably damaging 1.00
R4915:Mccc1 UTSW 3 36,051,703 (GRCm39) missense probably benign 0.00
R4917:Mccc1 UTSW 3 36,051,703 (GRCm39) missense probably benign 0.00
R5106:Mccc1 UTSW 3 36,026,713 (GRCm39) missense probably benign 0.22
R5168:Mccc1 UTSW 3 36,044,929 (GRCm39) nonsense probably null
R5241:Mccc1 UTSW 3 36,028,345 (GRCm39) missense probably benign 0.03
R5444:Mccc1 UTSW 3 36,030,891 (GRCm39) missense probably benign 0.00
R5677:Mccc1 UTSW 3 36,044,197 (GRCm39) critical splice donor site probably null
R5838:Mccc1 UTSW 3 36,039,231 (GRCm39) missense possibly damaging 0.88
R5881:Mccc1 UTSW 3 36,018,531 (GRCm39) missense probably benign 0.00
R6248:Mccc1 UTSW 3 36,044,313 (GRCm39) missense probably damaging 1.00
R6381:Mccc1 UTSW 3 36,030,876 (GRCm39) missense probably benign 0.13
R6564:Mccc1 UTSW 3 36,030,825 (GRCm39) missense probably damaging 1.00
R6612:Mccc1 UTSW 3 36,048,079 (GRCm39) missense probably benign 0.01
R6769:Mccc1 UTSW 3 36,043,992 (GRCm39) critical splice donor site probably null
R6771:Mccc1 UTSW 3 36,043,992 (GRCm39) critical splice donor site probably null
R7135:Mccc1 UTSW 3 36,049,967 (GRCm39) missense probably damaging 1.00
R7236:Mccc1 UTSW 3 36,037,944 (GRCm39) missense probably benign 0.13
R7274:Mccc1 UTSW 3 36,044,005 (GRCm39) missense probably damaging 1.00
R7577:Mccc1 UTSW 3 36,029,943 (GRCm39) critical splice donor site probably null
R7689:Mccc1 UTSW 3 36,015,132 (GRCm39) nonsense probably null
R8300:Mccc1 UTSW 3 36,017,753 (GRCm39) missense probably damaging 1.00
R8359:Mccc1 UTSW 3 36,018,493 (GRCm39) missense probably benign 0.00
R8701:Mccc1 UTSW 3 36,049,933 (GRCm39) missense probably benign
R9225:Mccc1 UTSW 3 36,018,511 (GRCm39) missense probably benign 0.00
R9331:Mccc1 UTSW 3 36,014,238 (GRCm39) missense probably damaging 0.98
R9407:Mccc1 UTSW 3 36,030,865 (GRCm39) missense possibly damaging 0.94
R9557:Mccc1 UTSW 3 36,049,976 (GRCm39) missense probably damaging 1.00
R9631:Mccc1 UTSW 3 36,014,185 (GRCm39) nonsense probably null
R9689:Mccc1 UTSW 3 36,030,903 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCAGCCTGAAAGGAGTCTG -3'
(R):5'- AGTCTGCGGTAGTGAAGTCAG -3'

Sequencing Primer
(F):5'- GTCTGGAATGTAATGTGTTCTCAAC -3'
(R):5'- TAGCATTCCTATGGAGGCCAG -3'
Posted On 2016-06-06