Incidental Mutation 'R5010:Gja8'
ID390419
Institutional Source Beutler Lab
Gene Symbol Gja8
Ensembl Gene ENSMUSG00000049908
Gene Namegap junction protein, alpha 8
SynonymsCx50, Cnx50, alpha 8 connexin, connexin 50, Lop10, Aey5
MMRRC Submission 042601-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5010 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location96913566-96926020 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 96919849 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 166 (T166A)
Ref Sequence ENSEMBL: ENSMUSP00000049532 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062944] [ENSMUST00000199597]
Predicted Effect probably benign
Transcript: ENSMUST00000062944
AA Change: T166A

PolyPhen 2 Score 0.243 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000049532
Gene: ENSMUSG00000049908
AA Change: T166A

DomainStartEndE-ValueType
CNX 43 76 1.76e-20 SMART
low complexity region 134 147 N/A INTRINSIC
Connexin_CCC 168 234 2.8e-41 SMART
Pfam:Connexin50 267 333 7.3e-35 PFAM
low complexity region 337 355 N/A INTRINSIC
low complexity region 423 438 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199597
SMART Domains Protein: ENSMUSP00000143542
Gene: ENSMUSG00000057123

DomainStartEndE-ValueType
CNX 43 76 3.47e-19 SMART
Connexin_CCC 163 229 2.45e-37 SMART
Pfam:Connexin40_C 257 358 2.4e-33 PFAM
Meta Mutation Damage Score 0.1096 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane connexin protein that is necessary for lens growth and maturation of lens fiber cells. The encoded protein is a component of gap junction channels and functions in a calcium and pH-dependent manner. Mutations in this gene have been associated with zonular pulverulent cataracts, nuclear progressive cataracts, and cataract-microcornea syndrome. [provided by RefSeq, Dec 2009]
PHENOTYPE: Homozygous mutants exhibit microphthalmia, with small lenses and nuclear or total cataracts. Heterozygotes may be equally or less affected, depending on the particular mutation and the genetic background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik C T 11: 58,422,804 A86V possibly damaging Het
9430097D07Rik A G 2: 32,574,428 probably benign Het
Actr5 T A 2: 158,635,363 D411E probably benign Het
Ang5 A G 14: 43,962,845 D122G probably benign Het
Atg9a A T 1: 75,186,060 probably null Het
C530008M17Rik G C 5: 76,657,834 probably benign Het
Dctd C T 8: 48,137,414 probably benign Het
Ddx11 G A 17: 66,147,722 V642M possibly damaging Het
Dis3l2 G A 1: 86,760,321 V100I probably benign Het
Echdc2 T C 4: 108,172,131 V111A probably benign Het
Egr1 A G 18: 34,863,658 T498A probably benign Het
Exosc3 T C 4: 45,317,702 K200R possibly damaging Het
Exosc8 T C 3: 54,729,223 D229G probably benign Het
Ext1 T A 15: 53,092,412 I430F probably damaging Het
Fbxw22 T C 9: 109,403,424 N31S probably benign Het
Gm21814 T A 6: 149,583,618 noncoding transcript Het
Gm21915 T A 9: 40,670,648 H12Q probably benign Het
Gm597 A G 1: 28,777,862 I363T possibly damaging Het
Hgsnat G A 8: 25,947,960 R527* probably null Het
Iqgap2 A G 13: 95,673,743 F731S probably benign Het
Jchain T C 5: 88,522,505 H85R probably damaging Het
Kcnb2 T C 1: 15,312,962 C171R probably benign Het
Kcnk3 C A 5: 30,622,805 R400S possibly damaging Het
Klhl28 C T 12: 64,957,227 E171K probably damaging Het
Lrrfip2 T C 9: 111,223,972 I375T possibly damaging Het
Mccc1 T C 3: 35,979,017 N326S probably benign Het
Med13l T C 5: 118,593,550 V97A possibly damaging Het
Mertk C A 2: 128,784,000 T685K probably benign Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Myom2 G A 8: 15,083,310 V401M probably damaging Het
Nme5 A C 18: 34,578,685 M1R probably null Het
Nop2 T C 6: 125,133,763 S68P probably benign Het
Notch1 A T 2: 26,476,114 D809E possibly damaging Het
Olfr292 T C 7: 86,694,585 I43T possibly damaging Het
Ppat C T 5: 76,928,678 probably benign Het
Prss23 T A 7: 89,510,214 M216L probably benign Het
Psg18 A T 7: 18,349,354 V171D probably damaging Het
Psg28 A G 7: 18,427,891 V229A probably damaging Het
Qser1 T C 2: 104,787,831 N879D possibly damaging Het
Rpap1 T C 2: 119,770,041 N879S probably benign Het
Rusc2 T C 4: 43,415,926 S411P probably damaging Het
Rxfp2 T A 5: 150,067,360 W519R probably damaging Het
Scpep1 T A 11: 88,941,349 Q185L probably benign Het
Serpinb11 A G 1: 107,379,649 N270S probably benign Het
Serpinb6d T A 13: 33,671,444 M367K probably benign Het
Skint10 T G 4: 112,727,672 I213L probably benign Het
Skint5 T C 4: 113,546,537 T1163A unknown Het
Slamf9 A T 1: 172,476,213 I42L possibly damaging Het
Slc1a3 T C 15: 8,650,846 probably benign Het
Smad6 T A 9: 63,953,900 Q371L possibly damaging Het
Snx31 A T 15: 36,555,324 V26E probably damaging Het
Taf4b A G 18: 14,822,172 N594S possibly damaging Het
Tanc2 T C 11: 105,780,092 S172P probably damaging Het
Tas2r110 T A 6: 132,868,475 Y156* probably null Het
Tbc1d20 G A 2: 152,293,936 probably benign Het
Timm50 A T 7: 28,306,859 D272E probably benign Het
Ttn T G 2: 76,900,511 probably benign Het
Vps13c T A 9: 67,916,379 F1362I probably benign Het
Vwf T C 6: 125,566,257 S154P probably benign Het
Zfp445 T C 9: 122,852,345 R844G probably benign Het
Other mutations in Gja8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01335:Gja8 APN 3 96919242 missense probably benign
IGL02114:Gja8 APN 3 96920025 missense probably benign 0.00
IGL02237:Gja8 APN 3 96919933 missense probably benign 0.00
IGL03204:Gja8 APN 3 96920092 missense probably damaging 1.00
L1 UTSW 3 96920197 missense probably damaging 1.00
R1024:Gja8 UTSW 3 96919424 missense probably benign 0.00
R2215:Gja8 UTSW 3 96919902 missense probably damaging 0.98
R2240:Gja8 UTSW 3 96920302 missense probably benign 0.05
R2510:Gja8 UTSW 3 96919717 missense probably damaging 1.00
R2511:Gja8 UTSW 3 96919717 missense probably damaging 1.00
R2926:Gja8 UTSW 3 96919153 missense probably benign 0.00
R3725:Gja8 UTSW 3 96919845 missense probably damaging 1.00
R4090:Gja8 UTSW 3 96919152 missense probably benign 0.00
R4933:Gja8 UTSW 3 96919035 intron probably benign
R5497:Gja8 UTSW 3 96920197 missense probably damaging 1.00
R5532:Gja8 UTSW 3 96920332 missense probably benign 0.39
R6997:Gja8 UTSW 3 96919341 missense probably benign
R7381:Gja8 UTSW 3 96920022 missense probably benign
R7576:Gja8 UTSW 3 96919893 missense probably benign 0.05
R7792:Gja8 UTSW 3 96919776 missense probably damaging 1.00
R7827:Gja8 UTSW 3 96920319 missense possibly damaging 0.52
R8444:Gja8 UTSW 3 96919674 missense probably damaging 1.00
Z1177:Gja8 UTSW 3 96920236 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATTCCTTTCATGCCCAGGTGG -3'
(R):5'- TACACCACGTTCGCATGGAG -3'

Sequencing Primer
(F):5'- CATCTCCATGATGTTGAGGAAGAGTG -3'
(R):5'- CGTTCGCATGGAGGAGAAGC -3'
Posted On2016-06-06