Incidental Mutation 'R5010:Echdc2'
ID390422
Institutional Source Beutler Lab
Gene Symbol Echdc2
Ensembl Gene ENSMUSG00000028601
Gene Nameenoyl Coenzyme A hydratase domain containing 2
Synonyms1300017C12Rik, 2610009M20Rik
MMRRC Submission 042601-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R5010 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location108165437-108179308 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108172131 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 111 (V111A)
Ref Sequence ENSEMBL: ENSMUSP00000112011 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052999] [ENSMUST00000116307] [ENSMUST00000116309] [ENSMUST00000125647] [ENSMUST00000126900] [ENSMUST00000130942]
Predicted Effect probably benign
Transcript: ENSMUST00000052999
AA Change: V111A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000051268
Gene: ENSMUSG00000028601
AA Change: V111A

DomainStartEndE-ValueType
Pfam:ECH_1 41 296 1.1e-60 PFAM
Pfam:ECH_2 46 225 5.1e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106691
SMART Domains Protein: ENSMUSP00000102302
Gene: ENSMUSG00000028601

DomainStartEndE-ValueType
Pfam:ECH_1 1 119 1.6e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116307
AA Change: V111A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000112009
Gene: ENSMUSG00000028601
AA Change: V111A

DomainStartEndE-ValueType
Pfam:ECH 39 131 6.7e-17 PFAM
Pfam:ECH 124 257 5.3e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116309
AA Change: V111A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000112011
Gene: ENSMUSG00000028601
AA Change: V111A

DomainStartEndE-ValueType
Pfam:ECH 39 288 3.2e-61 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123280
Predicted Effect probably benign
Transcript: ENSMUST00000125647
SMART Domains Protein: ENSMUSP00000123913
Gene: ENSMUSG00000028601

DomainStartEndE-ValueType
low complexity region 45 62 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126900
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127392
Predicted Effect probably benign
Transcript: ENSMUST00000130942
SMART Domains Protein: ENSMUSP00000124746
Gene: ENSMUSG00000028601

DomainStartEndE-ValueType
Pfam:ECH 39 103 8.6e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133049
Predicted Effect unknown
Transcript: ENSMUST00000135718
AA Change: V66A
SMART Domains Protein: ENSMUSP00000114371
Gene: ENSMUSG00000028601
AA Change: V66A

DomainStartEndE-ValueType
Pfam:ECH_1 1 74 9.6e-16 PFAM
Pfam:ECH_2 2 74 1.1e-11 PFAM
Pfam:ECH_1 69 184 2.8e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138701
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150487
Meta Mutation Damage Score 0.1607 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 98% (65/66)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik C T 11: 58,422,804 A86V possibly damaging Het
9430097D07Rik A G 2: 32,574,428 probably benign Het
Actr5 T A 2: 158,635,363 D411E probably benign Het
Ang5 A G 14: 43,962,845 D122G probably benign Het
Atg9a A T 1: 75,186,060 probably null Het
C530008M17Rik G C 5: 76,657,834 probably benign Het
Dctd C T 8: 48,137,414 probably benign Het
Ddx11 G A 17: 66,147,722 V642M possibly damaging Het
Dis3l2 G A 1: 86,760,321 V100I probably benign Het
Egr1 A G 18: 34,863,658 T498A probably benign Het
Exosc3 T C 4: 45,317,702 K200R possibly damaging Het
Exosc8 T C 3: 54,729,223 D229G probably benign Het
Ext1 T A 15: 53,092,412 I430F probably damaging Het
Fbxw22 T C 9: 109,403,424 N31S probably benign Het
Gja8 T C 3: 96,919,849 T166A probably benign Het
Gm21814 T A 6: 149,583,618 noncoding transcript Het
Gm21915 T A 9: 40,670,648 H12Q probably benign Het
Gm597 A G 1: 28,777,862 I363T possibly damaging Het
Hgsnat G A 8: 25,947,960 R527* probably null Het
Iqgap2 A G 13: 95,673,743 F731S probably benign Het
Jchain T C 5: 88,522,505 H85R probably damaging Het
Kcnb2 T C 1: 15,312,962 C171R probably benign Het
Kcnk3 C A 5: 30,622,805 R400S possibly damaging Het
Klhl28 C T 12: 64,957,227 E171K probably damaging Het
Lrrfip2 T C 9: 111,223,972 I375T possibly damaging Het
Mccc1 T C 3: 35,979,017 N326S probably benign Het
Med13l T C 5: 118,593,550 V97A possibly damaging Het
Mertk C A 2: 128,784,000 T685K probably benign Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Myom2 G A 8: 15,083,310 V401M probably damaging Het
Nme5 A C 18: 34,578,685 M1R probably null Het
Nop2 T C 6: 125,133,763 S68P probably benign Het
Notch1 A T 2: 26,476,114 D809E possibly damaging Het
Olfr292 T C 7: 86,694,585 I43T possibly damaging Het
Ppat C T 5: 76,928,678 probably benign Het
Prss23 T A 7: 89,510,214 M216L probably benign Het
Psg18 A T 7: 18,349,354 V171D probably damaging Het
Psg28 A G 7: 18,427,891 V229A probably damaging Het
Qser1 T C 2: 104,787,831 N879D possibly damaging Het
Rpap1 T C 2: 119,770,041 N879S probably benign Het
Rusc2 T C 4: 43,415,926 S411P probably damaging Het
Rxfp2 T A 5: 150,067,360 W519R probably damaging Het
Scpep1 T A 11: 88,941,349 Q185L probably benign Het
Serpinb11 A G 1: 107,379,649 N270S probably benign Het
Serpinb6d T A 13: 33,671,444 M367K probably benign Het
Skint10 T G 4: 112,727,672 I213L probably benign Het
Skint5 T C 4: 113,546,537 T1163A unknown Het
Slamf9 A T 1: 172,476,213 I42L possibly damaging Het
Slc1a3 T C 15: 8,650,846 probably benign Het
Smad6 T A 9: 63,953,900 Q371L possibly damaging Het
Snx31 A T 15: 36,555,324 V26E probably damaging Het
Taf4b A G 18: 14,822,172 N594S possibly damaging Het
Tanc2 T C 11: 105,780,092 S172P probably damaging Het
Tas2r110 T A 6: 132,868,475 Y156* probably null Het
Tbc1d20 G A 2: 152,293,936 probably benign Het
Timm50 A T 7: 28,306,859 D272E probably benign Het
Ttn T G 2: 76,900,511 probably benign Het
Vps13c T A 9: 67,916,379 F1362I probably benign Het
Vwf T C 6: 125,566,257 S154P probably benign Het
Zfp445 T C 9: 122,852,345 R844G probably benign Het
Other mutations in Echdc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Echdc2 APN 4 108178911 missense probably damaging 1.00
IGL03122:Echdc2 APN 4 108165580 missense probably benign 0.00
IGL03201:Echdc2 APN 4 108169870 missense possibly damaging 0.87
R1579:Echdc2 UTSW 4 108173809 missense probably benign 0.01
R1836:Echdc2 UTSW 4 108165535 missense probably damaging 0.99
R4994:Echdc2 UTSW 4 108165628 missense probably benign 0.21
R5111:Echdc2 UTSW 4 108169797 splice site probably benign
R5880:Echdc2 UTSW 4 108172900 missense possibly damaging 0.87
R7175:Echdc2 UTSW 4 108174169 missense probably damaging 1.00
R7699:Echdc2 UTSW 4 108174077 missense probably benign
R7700:Echdc2 UTSW 4 108174077 missense probably benign
R8301:Echdc2 UTSW 4 108172909 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTCTCTGCACTGATACCTGC -3'
(R):5'- GAGAAGATATGCCTCTCCCTCTC -3'

Sequencing Primer
(F):5'- GCCCCTGCAACTGGGTTTC -3'
(R):5'- CTATGTAACCCCATGTACCCC -3'
Posted On2016-06-06