Mutagenetix > Incidental Mutation

Incidental Mutation 'R5010:Kcnk3'

390424

Institutional Source

Beutler Lab

Gene Symbol

Kcnk3

Ensembl Gene

ENSMUSG00000049265

Gene Name

potassium channel, subfamily K, member 3

Synonyms

cTBAK-1, Task-1

MMRRC Submission

042601-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.128) question?

Stock #

R5010 (G1)

Quality Score

153

Status

Validated

Chromosome

Chromosomal Location

30588170-30625271 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 30622805 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Serine at position 400 (R400S)

Ref Sequence

ENSEMBL: ENSMUSP00000098987 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066295]

AlphaFold

O35111

Predicted Effect

possibly damaging
Transcript: ENSMUST00000066295
AA Change: R400S

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000098987
Gene: ENSMUSG00000049265
AA Change: R400S

Domain	Start	End	E-Value	Type
transmembrane domain	9	26	N/A	INTRINSIC
low complexity region	37	49	N/A	INTRINSIC
Pfam:Ion_trans_2	58	134	2.9e-20	PFAM
Pfam:Ion_trans_2	165	248	1.4e-21	PFAM
low complexity region	272	286	N/A	INTRINSIC
low complexity region	296	308	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197428

Meta Mutation Damage Score

0.0619

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.6%

Validation Efficiency

98% (65/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the superfamily of potassium channel proteins that contain two pore-forming P domains. The encoded protein is an outwardly rectifying channel that is sensitive to changes in extracellular pH and is inhibited by extracellular acidification. Also referred to as an acid-sensitive potassium channel, it is activated by the anesthetics halothane and isoflurane. Although three transcripts are detected in northern blots, there is currently no sequence available to confirm transcript variants for this gene. [provided by RefSeq, Aug 2008]
PHENOTYPE: Mice homozygous for a null alleles exhibit decreased pH sensitivitive of action potential in serotonergic neurons. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810065E05Rik	C	T	11: 58,422,804	A86V	possibly damaging	Het
9430097D07Rik	A	G	2: 32,574,428		probably benign	Het
Actr5	T	A	2: 158,635,363	D411E	probably benign	Het
Ang5	A	G	14: 43,962,845	D122G	probably benign	Het
Atg9a	A	T	1: 75,186,060		probably null	Het
C530008M17Rik	G	C	5: 76,657,834		probably benign	Het
Dctd	C	T	8: 48,137,414		probably benign	Het
Ddx11	G	A	17: 66,147,722	V642M	possibly damaging	Het
Dis3l2	G	A	1: 86,760,321	V100I	probably benign	Het
Echdc2	T	C	4: 108,172,131	V111A	probably benign	Het
Egr1	A	G	18: 34,863,658	T498A	probably benign	Het
Exosc3	T	C	4: 45,317,702	K200R	possibly damaging	Het
Exosc8	T	C	3: 54,729,223	D229G	probably benign	Het
Ext1	T	A	15: 53,092,412	I430F	probably damaging	Het
Fbxw22	T	C	9: 109,403,424	N31S	probably benign	Het
Gja8	T	C	3: 96,919,849	T166A	probably benign	Het
Gm21814	T	A	6: 149,583,618		noncoding transcript	Het
Gm21915	T	A	9: 40,670,648	H12Q	probably benign	Het
Gm597	A	G	1: 28,777,862	I363T	possibly damaging	Het
Hgsnat	G	A	8: 25,947,960	R527*	probably null	Het
Iqgap2	A	G	13: 95,673,743	F731S	probably benign	Het
Jchain	T	C	5: 88,522,505	H85R	probably damaging	Het
Kcnb2	T	C	1: 15,312,962	C171R	probably benign	Het
Klhl28	C	T	12: 64,957,227	E171K	probably damaging	Het
Lrrfip2	T	C	9: 111,223,972	I375T	possibly damaging	Het
Mccc1	T	C	3: 35,979,017	N326S	probably benign	Het
Med13l	T	C	5: 118,593,550	V97A	possibly damaging	Het
Mertk	C	A	2: 128,784,000	T685K	probably benign	Het
Msh2	C	A	17: 87,723,413	A906E	probably benign	Het
Myom2	G	A	8: 15,083,310	V401M	probably damaging	Het
Nme5	A	C	18: 34,578,685	M1R	probably null	Het
Nop2	T	C	6: 125,133,763	S68P	probably benign	Het
Notch1	A	T	2: 26,476,114	D809E	possibly damaging	Het
Olfr292	T	C	7: 86,694,585	I43T	possibly damaging	Het
Ppat	C	T	5: 76,928,678		probably benign	Het
Prss23	T	A	7: 89,510,214	M216L	probably benign	Het
Psg18	A	T	7: 18,349,354	V171D	probably damaging	Het
Psg28	A	G	7: 18,427,891	V229A	probably damaging	Het
Qser1	T	C	2: 104,787,831	N879D	possibly damaging	Het
Rpap1	T	C	2: 119,770,041	N879S	probably benign	Het
Rusc2	T	C	4: 43,415,926	S411P	probably damaging	Het
Rxfp2	T	A	5: 150,067,360	W519R	probably damaging	Het
Scpep1	T	A	11: 88,941,349	Q185L	probably benign	Het
Serpinb11	A	G	1: 107,379,649	N270S	probably benign	Het
Serpinb6d	T	A	13: 33,671,444	M367K	probably benign	Het
Skint10	T	G	4: 112,727,672	I213L	probably benign	Het
Skint5	T	C	4: 113,546,537	T1163A	unknown	Het
Slamf9	A	T	1: 172,476,213	I42L	possibly damaging	Het
Slc1a3	T	C	15: 8,650,846		probably benign	Het
Smad6	T	A	9: 63,953,900	Q371L	possibly damaging	Het
Snx31	A	T	15: 36,555,324	V26E	probably damaging	Het
Taf4b	A	G	18: 14,822,172	N594S	possibly damaging	Het
Tanc2	T	C	11: 105,780,092	S172P	probably damaging	Het
Tas2r110	T	A	6: 132,868,475	Y156*	probably null	Het
Tbc1d20	G	A	2: 152,293,936		probably benign	Het
Timm50	A	T	7: 28,306,859	D272E	probably benign	Het
Ttn	T	G	2: 76,900,511		probably benign	Het
Vps13c	T	A	9: 67,916,379	F1362I	probably benign	Het
Vwf	T	C	6: 125,566,257	S154P	probably benign	Het
Zfp445	T	C	9: 122,852,345	R844G	probably benign	Het

Other mutations in Kcnk3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02481:Kcnk3	APN	5	30622383	missense	probably damaging	0.99
IGL02719:Kcnk3	APN	5	30621980	missense	probably damaging	1.00
PIT4802001:Kcnk3	UTSW	5	30622368	missense	probably damaging	1.00
R0288:Kcnk3	UTSW	5	30588420	missense	probably benign
R0834:Kcnk3	UTSW	5	30622635	missense	probably damaging	1.00
R1740:Kcnk3	UTSW	5	30621977	missense	possibly damaging	0.95
R2656:Kcnk3	UTSW	5	30622671	missense	possibly damaging	0.55
R2923:Kcnk3	UTSW	5	30622070	missense	probably damaging	1.00
R3740:Kcnk3	UTSW	5	30621930	missense	possibly damaging	0.93
R4584:Kcnk3	UTSW	5	30588386	missense	probably damaging	0.99
R5070:Kcnk3	UTSW	5	30622386	missense	possibly damaging	0.77
R5427:Kcnk3	UTSW	5	30622295	missense	possibly damaging	0.86
R5669:Kcnk3	UTSW	5	30622349	missense	probably damaging	0.99
R5956:Kcnk3	UTSW	5	30588510	missense	probably damaging	1.00
R5982:Kcnk3	UTSW	5	30622670	missense	probably benign	0.18
R5986:Kcnk3	UTSW	5	30588378	missense	possibly damaging	0.68
R6318:Kcnk3	UTSW	5	30622586	missense	probably damaging	0.98
R6860:Kcnk3	UTSW	5	30622053	missense	possibly damaging	0.86
R6919:Kcnk3	UTSW	5	30622400	missense	probably benign	0.00
R7350:Kcnk3	UTSW	5	30621966	missense	probably damaging	1.00
R7418:Kcnk3	UTSW	5	30622331	missense	possibly damaging	0.57
R7502:Kcnk3	UTSW	5	30622718	missense	possibly damaging	0.85
R7922:Kcnk3	UTSW	5	30588531	missense	probably damaging	1.00
R8899:Kcnk3	UTSW	5	30622236	missense	probably benign	0.37
R8953:Kcnk3	UTSW	5	30622038	missense	probably damaging	1.00
R9180:Kcnk3	UTSW	5	30588188	start gained	probably benign
R9570:Kcnk3	UTSW	5	30622089	missense	possibly damaging	0.94
Z1177:Kcnk3	UTSW	5	30588274	start gained	probably benign
Z1177:Kcnk3	UTSW	5	30622493	missense	probably benign
Z1177:Kcnk3	UTSW	5	30622704	missense	possibly damaging	0.80

Predicted Primers

PCR Primer
(F):5'- TGCAGTACTCCATCCCCATG -3'
(R):5'- CCTGCACAGTTGGAGATTTAGGG -3'

Sequencing Primer
(F):5'- CCATGATCATCCCGCGG -3'
(R):5'- ACAGTTGGAGATTTAGGGGCTGG -3'

Posted On

2016-06-06