Incidental Mutation 'R5010:C530008M17Rik'
ID390425
Institutional Source Beutler Lab
Gene Symbol C530008M17Rik
Ensembl Gene ENSMUSG00000036377
Gene NameRIKEN cDNA C530008M17 gene
Synonyms
MMRRC Submission 042601-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5010 (G1)
Quality Score101
Status Validated
Chromosome5
Chromosomal Location76656512-76873554 bp(+) (GRCm38)
Type of Mutationutr 5 prime
DNA Base Change (assembly) G to C at 76657834 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119799 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086909] [ENSMUST00000128112]
Predicted Effect unknown
Transcript: ENSMUST00000086909
AA Change: R51P
SMART Domains Protein: ENSMUSP00000084125
Gene: ENSMUSG00000036377
AA Change: R51P

DomainStartEndE-ValueType
low complexity region 23 31 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125922
Predicted Effect probably benign
Transcript: ENSMUST00000128112
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187287
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194526
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 98% (65/66)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik C T 11: 58,422,804 A86V possibly damaging Het
9430097D07Rik A G 2: 32,574,428 probably benign Het
Actr5 T A 2: 158,635,363 D411E probably benign Het
Ang5 A G 14: 43,962,845 D122G probably benign Het
Atg9a A T 1: 75,186,060 probably null Het
Dctd C T 8: 48,137,414 probably benign Het
Ddx11 G A 17: 66,147,722 V642M possibly damaging Het
Dis3l2 G A 1: 86,760,321 V100I probably benign Het
Echdc2 T C 4: 108,172,131 V111A probably benign Het
Egr1 A G 18: 34,863,658 T498A probably benign Het
Exosc3 T C 4: 45,317,702 K200R possibly damaging Het
Exosc8 T C 3: 54,729,223 D229G probably benign Het
Ext1 T A 15: 53,092,412 I430F probably damaging Het
Fbxw22 T C 9: 109,403,424 N31S probably benign Het
Gja8 T C 3: 96,919,849 T166A probably benign Het
Gm21814 T A 6: 149,583,618 noncoding transcript Het
Gm21915 T A 9: 40,670,648 H12Q probably benign Het
Gm597 A G 1: 28,777,862 I363T possibly damaging Het
Hgsnat G A 8: 25,947,960 R527* probably null Het
Iqgap2 A G 13: 95,673,743 F731S probably benign Het
Jchain T C 5: 88,522,505 H85R probably damaging Het
Kcnb2 T C 1: 15,312,962 C171R probably benign Het
Kcnk3 C A 5: 30,622,805 R400S possibly damaging Het
Klhl28 C T 12: 64,957,227 E171K probably damaging Het
Lrrfip2 T C 9: 111,223,972 I375T possibly damaging Het
Mccc1 T C 3: 35,979,017 N326S probably benign Het
Med13l T C 5: 118,593,550 V97A possibly damaging Het
Mertk C A 2: 128,784,000 T685K probably benign Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Myom2 G A 8: 15,083,310 V401M probably damaging Het
Nme5 A C 18: 34,578,685 M1R probably null Het
Nop2 T C 6: 125,133,763 S68P probably benign Het
Notch1 A T 2: 26,476,114 D809E possibly damaging Het
Olfr292 T C 7: 86,694,585 I43T possibly damaging Het
Ppat C T 5: 76,928,678 probably benign Het
Prss23 T A 7: 89,510,214 M216L probably benign Het
Psg18 A T 7: 18,349,354 V171D probably damaging Het
Psg28 A G 7: 18,427,891 V229A probably damaging Het
Qser1 T C 2: 104,787,831 N879D possibly damaging Het
Rpap1 T C 2: 119,770,041 N879S probably benign Het
Rusc2 T C 4: 43,415,926 S411P probably damaging Het
Rxfp2 T A 5: 150,067,360 W519R probably damaging Het
Scpep1 T A 11: 88,941,349 Q185L probably benign Het
Serpinb11 A G 1: 107,379,649 N270S probably benign Het
Serpinb6d T A 13: 33,671,444 M367K probably benign Het
Skint10 T G 4: 112,727,672 I213L probably benign Het
Skint5 T C 4: 113,546,537 T1163A unknown Het
Slamf9 A T 1: 172,476,213 I42L possibly damaging Het
Slc1a3 T C 15: 8,650,846 probably benign Het
Smad6 T A 9: 63,953,900 Q371L possibly damaging Het
Snx31 A T 15: 36,555,324 V26E probably damaging Het
Taf4b A G 18: 14,822,172 N594S possibly damaging Het
Tanc2 T C 11: 105,780,092 S172P probably damaging Het
Tas2r110 T A 6: 132,868,475 Y156* probably null Het
Tbc1d20 G A 2: 152,293,936 probably benign Het
Timm50 A T 7: 28,306,859 D272E probably benign Het
Ttn T G 2: 76,900,511 probably benign Het
Vps13c T A 9: 67,916,379 F1362I probably benign Het
Vwf T C 6: 125,566,257 S154P probably benign Het
Zfp445 T C 9: 122,852,345 R844G probably benign Het
Other mutations in C530008M17Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:C530008M17Rik APN 5 76866056 unclassified probably benign
IGL00660:C530008M17Rik APN 5 76854933 critical splice acceptor site probably null
IGL00924:C530008M17Rik APN 5 76858986 missense unknown
IGL01025:C530008M17Rik APN 5 76658074 intron probably benign
IGL01122:C530008M17Rik APN 5 76870675 makesense probably null
IGL01393:C530008M17Rik APN 5 76858971 missense unknown
IGL01526:C530008M17Rik APN 5 76857631 missense unknown
IGL01986:C530008M17Rik APN 5 76858610 missense unknown
IGL02009:C530008M17Rik APN 5 76848970 missense possibly damaging 0.61
IGL02724:C530008M17Rik APN 5 76858459 missense unknown
IGL02869:C530008M17Rik APN 5 76859043 missense unknown
IGL03030:C530008M17Rik APN 5 76857616 missense unknown
IGL03150:C530008M17Rik APN 5 76867250 missense probably damaging 0.99
LCD18:C530008M17Rik UTSW 5 76658742 intron probably benign
R0975:C530008M17Rik UTSW 5 76856318 splice site probably benign
R1329:C530008M17Rik UTSW 5 76657932 intron probably benign
R1439:C530008M17Rik UTSW 5 76840910 missense probably damaging 0.99
R1750:C530008M17Rik UTSW 5 76857675 missense unknown
R1773:C530008M17Rik UTSW 5 76867205 missense possibly damaging 0.54
R1885:C530008M17Rik UTSW 5 76856742 missense unknown
R1924:C530008M17Rik UTSW 5 76858623 missense unknown
R2483:C530008M17Rik UTSW 5 76856409 missense probably damaging 0.98
R3840:C530008M17Rik UTSW 5 76859011 missense unknown
R3841:C530008M17Rik UTSW 5 76859011 missense unknown
R3874:C530008M17Rik UTSW 5 76840892 missense probably damaging 1.00
R3883:C530008M17Rik UTSW 5 76856574 missense unknown
R4033:C530008M17Rik UTSW 5 76858465 missense unknown
R4401:C530008M17Rik UTSW 5 76848916 missense probably damaging 0.98
R4749:C530008M17Rik UTSW 5 76858834 missense unknown
R4884:C530008M17Rik UTSW 5 76848835 missense probably damaging 1.00
R4980:C530008M17Rik UTSW 5 76857574 missense unknown
R5086:C530008M17Rik UTSW 5 76857124 missense unknown
R5468:C530008M17Rik UTSW 5 76840763 intron probably benign
R5786:C530008M17Rik UTSW 5 76866196 splice site probably null
R5813:C530008M17Rik UTSW 5 76858428 missense unknown
R5866:C530008M17Rik UTSW 5 76857537 missense unknown
R5928:C530008M17Rik UTSW 5 76841734 intron probably benign
R6273:C530008M17Rik UTSW 5 76857721 missense unknown
R6577:C530008M17Rik UTSW 5 76866100 unclassified probably benign
R6838:C530008M17Rik UTSW 5 76858209 missense unknown
R6849:C530008M17Rik UTSW 5 76857010 missense unknown
R6849:C530008M17Rik UTSW 5 76857157 missense unknown
R6914:C530008M17Rik UTSW 5 76857007 missense unknown
R7017:C530008M17Rik UTSW 5 76856948 small deletion probably benign
R7094:C530008M17Rik UTSW 5 76859032 missense unknown
R7367:C530008M17Rik UTSW 5 76856602 missense unknown
R7394:C530008M17Rik UTSW 5 76856954 small deletion probably benign
R7436:C530008M17Rik UTSW 5 76856954 small deletion probably benign
R7443:C530008M17Rik UTSW 5 76856638 missense unknown
R7500:C530008M17Rik UTSW 5 76658058 missense unknown
R7566:C530008M17Rik UTSW 5 76866275 splice site probably null
R7633:C530008M17Rik UTSW 5 76857520 missense unknown
R7728:C530008M17Rik UTSW 5 76857469 missense unknown
R7930:C530008M17Rik UTSW 5 76856954 small deletion probably benign
R7985:C530008M17Rik UTSW 5 76658050 missense unknown
R8154:C530008M17Rik UTSW 5 76841797 missense unknown
Z1176:C530008M17Rik UTSW 5 76857246 missense unknown
Predicted Primers PCR Primer
(F):5'- TAACTCCTGCTTTCGAGTCAGC -3'
(R):5'- AACAAAGCCATGCAGCCTGG -3'

Sequencing Primer
(F):5'- TGCAAAGTGTCCGGCATG -3'
(R):5'- TCTCAGCTCCTGGTTAGCGAG -3'
Posted On2016-06-06