Incidental Mutation 'R5010:Ppat'
ID 390426
Institutional Source Beutler Lab
Gene Symbol Ppat
Ensembl Gene ENSMUSG00000029246
Gene Name phosphoribosyl pyrophosphate amidotransferase
Synonyms 5730454C12Rik
MMRRC Submission 042601-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.966) question?
Stock # R5010 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 77061096-77099425 bp(-) (GRCm39)
Type of Mutation intron
DNA Base Change (assembly) C to T at 77076525 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116438 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000140076] [ENSMUST00000155272]
AlphaFold Q8CIH9
Predicted Effect noncoding transcript
Transcript: ENSMUST00000031158
Predicted Effect noncoding transcript
Transcript: ENSMUST00000101090
Predicted Effect probably benign
Transcript: ENSMUST00000140076
SMART Domains Protein: ENSMUSP00000120632
Gene: ENSMUSG00000029246

DomainStartEndE-ValueType
Pfam:GATase_4 27 218 4e-11 PFAM
Pfam:GATase_6 74 216 1.6e-18 PFAM
Pfam:GATase_7 91 241 1.6e-16 PFAM
Pfam:Pribosyltran 309 420 1.3e-9 PFAM
low complexity region 474 482 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145897
Predicted Effect probably benign
Transcript: ENSMUST00000155272
SMART Domains Protein: ENSMUSP00000116438
Gene: ENSMUSG00000029246

DomainStartEndE-ValueType
SCOP:d1ecfa2 12 43 6e-3 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the purine/pyrimidine phosphoribosyltransferase family. It is a regulatory allosteric enzyme that catalyzes the first step of de novo purine nucleotide biosythetic pathway. This gene and PAICS/AIRC gene, a bifunctional enzyme catalyzing steps six and seven of this pathway, are located in close proximity on chromosome 4, and divergently transcribed from an intergenic region. [provided by RefSeq, Mar 2011]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik C T 11: 58,313,630 (GRCm39) A86V possibly damaging Het
9430097D07Rik A G 2: 32,464,440 (GRCm39) probably benign Het
Actr5 T A 2: 158,477,283 (GRCm39) D411E probably benign Het
Ang5 A G 14: 44,200,302 (GRCm39) D122G probably benign Het
Atg9a A T 1: 75,162,704 (GRCm39) probably null Het
Cracd G C 5: 76,805,681 (GRCm39) probably benign Het
Dctd C T 8: 48,590,449 (GRCm39) probably benign Het
Ddx11 G A 17: 66,454,717 (GRCm39) V642M possibly damaging Het
Dis3l2 G A 1: 86,688,043 (GRCm39) V100I probably benign Het
Echdc2 T C 4: 108,029,328 (GRCm39) V111A probably benign Het
Egr1 A G 18: 34,996,711 (GRCm39) T498A probably benign Het
Exosc3 T C 4: 45,317,702 (GRCm39) K200R possibly damaging Het
Exosc8 T C 3: 54,636,644 (GRCm39) D229G probably benign Het
Ext1 T A 15: 52,955,808 (GRCm39) I430F probably damaging Het
Fbxw22 T C 9: 109,232,492 (GRCm39) N31S probably benign Het
Gja8 T C 3: 96,827,165 (GRCm39) T166A probably benign Het
Gm21814 T A 6: 149,485,116 (GRCm39) noncoding transcript Het
Gm21915 T A 9: 40,581,944 (GRCm39) H12Q probably benign Het
Hgsnat G A 8: 26,437,988 (GRCm39) R527* probably null Het
Iqgap2 A G 13: 95,810,251 (GRCm39) F731S probably benign Het
Jchain T C 5: 88,670,364 (GRCm39) H85R probably damaging Het
Kcnb2 T C 1: 15,383,186 (GRCm39) C171R probably benign Het
Kcnk3 C A 5: 30,780,149 (GRCm39) R400S possibly damaging Het
Klhl28 C T 12: 65,004,001 (GRCm39) E171K probably damaging Het
Lrrfip2 T C 9: 111,053,040 (GRCm39) I375T possibly damaging Het
Mccc1 T C 3: 36,033,166 (GRCm39) N326S probably benign Het
Med13l T C 5: 118,731,615 (GRCm39) V97A possibly damaging Het
Mertk C A 2: 128,625,920 (GRCm39) T685K probably benign Het
Msh2 C A 17: 88,030,841 (GRCm39) A906E probably benign Het
Myom2 G A 8: 15,133,310 (GRCm39) V401M probably damaging Het
Nme5 A C 18: 34,711,738 (GRCm39) M1R probably null Het
Nop2 T C 6: 125,110,726 (GRCm39) S68P probably benign Het
Notch1 A T 2: 26,366,126 (GRCm39) D809E possibly damaging Het
Or14c39 T C 7: 86,343,793 (GRCm39) I43T possibly damaging Het
Prss23 T A 7: 89,159,422 (GRCm39) M216L probably benign Het
Psg18 A T 7: 18,083,279 (GRCm39) V171D probably damaging Het
Psg28 A G 7: 18,161,816 (GRCm39) V229A probably damaging Het
Qser1 T C 2: 104,618,176 (GRCm39) N879D possibly damaging Het
Rpap1 T C 2: 119,600,522 (GRCm39) N879S probably benign Het
Rusc2 T C 4: 43,415,926 (GRCm39) S411P probably damaging Het
Rxfp2 T A 5: 149,990,825 (GRCm39) W519R probably damaging Het
Scpep1 T A 11: 88,832,175 (GRCm39) Q185L probably benign Het
Serpinb11 A G 1: 107,307,379 (GRCm39) N270S probably benign Het
Serpinb6d T A 13: 33,855,427 (GRCm39) M367K probably benign Het
Skint10 T G 4: 112,584,869 (GRCm39) I213L probably benign Het
Skint5 T C 4: 113,403,734 (GRCm39) T1163A unknown Het
Slamf9 A T 1: 172,303,780 (GRCm39) I42L possibly damaging Het
Slc1a3 T C 15: 8,680,330 (GRCm39) probably benign Het
Smad6 T A 9: 63,861,182 (GRCm39) Q371L possibly damaging Het
Snx31 A T 15: 36,555,469 (GRCm39) V26E probably damaging Het
Spata31e5 A G 1: 28,816,943 (GRCm39) I363T possibly damaging Het
Taf4b A G 18: 14,955,229 (GRCm39) N594S possibly damaging Het
Tanc2 T C 11: 105,670,918 (GRCm39) S172P probably damaging Het
Tas2r110 T A 6: 132,845,438 (GRCm39) Y156* probably null Het
Tbc1d20 G A 2: 152,135,856 (GRCm39) probably benign Het
Timm50 A T 7: 28,006,284 (GRCm39) D272E probably benign Het
Ttn T G 2: 76,730,855 (GRCm39) probably benign Het
Vps13c T A 9: 67,823,661 (GRCm39) F1362I probably benign Het
Vwf T C 6: 125,543,220 (GRCm39) S154P probably benign Het
Zfp445 T C 9: 122,681,410 (GRCm39) R844G probably benign Het
Other mutations in Ppat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02545:Ppat APN 5 77,063,079 (GRCm39) missense probably damaging 1.00
IGL02679:Ppat APN 5 77,067,316 (GRCm39) missense probably benign 0.10
R0836:Ppat UTSW 5 77,070,348 (GRCm39) missense probably benign 0.09
R2327:Ppat UTSW 5 77,070,314 (GRCm39) missense possibly damaging 0.94
R2850:Ppat UTSW 5 77,067,222 (GRCm39) missense probably benign
R3434:Ppat UTSW 5 77,065,912 (GRCm39) missense probably damaging 0.99
R4301:Ppat UTSW 5 77,076,348 (GRCm39) intron probably benign
R4422:Ppat UTSW 5 77,063,061 (GRCm39) missense probably damaging 1.00
R4423:Ppat UTSW 5 77,063,061 (GRCm39) missense probably damaging 1.00
R4424:Ppat UTSW 5 77,063,061 (GRCm39) missense probably damaging 1.00
R4839:Ppat UTSW 5 77,098,811 (GRCm39) nonsense probably null
R4872:Ppat UTSW 5 77,074,640 (GRCm39) missense probably damaging 0.99
R5007:Ppat UTSW 5 77,076,525 (GRCm39) intron probably benign
R5325:Ppat UTSW 5 77,076,269 (GRCm39) intron probably benign
R5982:Ppat UTSW 5 77,063,112 (GRCm39) missense probably benign
R6209:Ppat UTSW 5 77,065,993 (GRCm39) missense probably benign 0.00
R6225:Ppat UTSW 5 77,070,202 (GRCm39) missense probably damaging 0.99
R6287:Ppat UTSW 5 77,066,061 (GRCm39) nonsense probably null
R7367:Ppat UTSW 5 77,067,711 (GRCm39) nonsense probably null
R7426:Ppat UTSW 5 77,063,826 (GRCm39) missense probably damaging 0.99
R7945:Ppat UTSW 5 77,063,238 (GRCm39) missense probably benign 0.01
R8047:Ppat UTSW 5 77,073,557 (GRCm39) missense probably damaging 1.00
R9343:Ppat UTSW 5 77,063,884 (GRCm39) missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- GTCGCTAAAAGGCTGCAAAC -3'
(R):5'- TTGGAAATTCATACCTTGTGCC -3'

Sequencing Primer
(F):5'- GTCGCTAAAAGGCTGCAAACACTAG -3'
(R):5'- ACCTTGTGCCAAATAGTATGTTG -3'
Posted On 2016-06-06