Incidental Mutation 'R5010:Nop2'
ID390430
Institutional Source Beutler Lab
Gene Symbol Nop2
Ensembl Gene ENSMUSG00000038279
Gene NameNOP2 nucleolar protein
Synonyms120kDa, Nol1
MMRRC Submission 042601-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R5010 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location125131909-125144753 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 125133763 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 68 (S68P)
Ref Sequence ENSEMBL: ENSMUSP00000145333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044200] [ENSMUST00000056889] [ENSMUST00000112390] [ENSMUST00000112392] [ENSMUST00000204185]
Predicted Effect probably benign
Transcript: ENSMUST00000044200
AA Change: S68P

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000047123
Gene: ENSMUSG00000038279
AA Change: S68P

DomainStartEndE-ValueType
low complexity region 41 57 N/A INTRINSIC
low complexity region 97 109 N/A INTRINSIC
low complexity region 166 176 N/A INTRINSIC
Pfam:Methyltr_RsmF_N 268 359 2.9e-12 PFAM
Pfam:Nol1_Nop2_Fmu 362 570 2e-86 PFAM
Pfam:P120R 609 630 2.7e-11 PFAM
Pfam:P120R 663 685 1.1e-12 PFAM
low complexity region 729 745 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000056889
SMART Domains Protein: ENSMUSP00000060054
Gene: ENSMUSG00000063870

DomainStartEndE-ValueType
low complexity region 29 45 N/A INTRINSIC
low complexity region 49 69 N/A INTRINSIC
low complexity region 80 92 N/A INTRINSIC
low complexity region 107 144 N/A INTRINSIC
Pfam:CHDNT 156 210 7.7e-35 PFAM
low complexity region 217 249 N/A INTRINSIC
low complexity region 271 291 N/A INTRINSIC
low complexity region 296 318 N/A INTRINSIC
low complexity region 321 347 N/A INTRINSIC
PHD 365 408 7.17e-15 SMART
RING 366 407 7.46e-1 SMART
low complexity region 424 443 N/A INTRINSIC
PHD 444 487 4.41e-15 SMART
RING 445 486 2.63e0 SMART
CHROMO 492 572 8.11e-17 SMART
CHROMO 613 670 1.98e-11 SMART
low complexity region 675 694 N/A INTRINSIC
DEXDc 715 927 2.73e-37 SMART
low complexity region 1044 1056 N/A INTRINSIC
HELICc 1073 1157 7.61e-27 SMART
DUF1087 1282 1346 5.56e-33 SMART
DUF1086 1359 1516 4.05e-108 SMART
low complexity region 1526 1540 N/A INTRINSIC
low complexity region 1560 1578 N/A INTRINSIC
low complexity region 1590 1633 N/A INTRINSIC
low complexity region 1635 1653 N/A INTRINSIC
low complexity region 1661 1674 N/A INTRINSIC
Pfam:CHDCT2 1727 1899 1.9e-98 PFAM
low complexity region 1903 1915 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112390
SMART Domains Protein: ENSMUSP00000108009
Gene: ENSMUSG00000063870

DomainStartEndE-ValueType
low complexity region 29 45 N/A INTRINSIC
low complexity region 49 69 N/A INTRINSIC
low complexity region 87 99 N/A INTRINSIC
low complexity region 114 151 N/A INTRINSIC
Pfam:CHDNT 164 217 2e-28 PFAM
low complexity region 224 256 N/A INTRINSIC
low complexity region 278 298 N/A INTRINSIC
low complexity region 303 325 N/A INTRINSIC
low complexity region 328 354 N/A INTRINSIC
PHD 372 415 7.17e-15 SMART
RING 373 414 7.46e-1 SMART
low complexity region 431 450 N/A INTRINSIC
PHD 451 494 4.41e-15 SMART
RING 452 493 2.63e0 SMART
CHROMO 499 579 8.11e-17 SMART
CHROMO 620 677 1.98e-11 SMART
low complexity region 682 701 N/A INTRINSIC
DEXDc 722 934 2.73e-37 SMART
low complexity region 1051 1063 N/A INTRINSIC
HELICc 1080 1164 7.61e-27 SMART
DUF1087 1289 1353 5.56e-33 SMART
DUF1086 1366 1523 4.05e-108 SMART
low complexity region 1533 1547 N/A INTRINSIC
low complexity region 1567 1585 N/A INTRINSIC
low complexity region 1597 1640 N/A INTRINSIC
low complexity region 1642 1660 N/A INTRINSIC
low complexity region 1668 1681 N/A INTRINSIC
Pfam:CHDCT2 1735 1906 4.3e-90 PFAM
low complexity region 1910 1922 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112392
SMART Domains Protein: ENSMUSP00000108011
Gene: ENSMUSG00000063870

DomainStartEndE-ValueType
low complexity region 29 45 N/A INTRINSIC
low complexity region 49 69 N/A INTRINSIC
low complexity region 80 92 N/A INTRINSIC
low complexity region 107 144 N/A INTRINSIC
Pfam:CHDNT 156 210 1.1e-34 PFAM
low complexity region 217 249 N/A INTRINSIC
low complexity region 271 291 N/A INTRINSIC
low complexity region 296 318 N/A INTRINSIC
low complexity region 321 347 N/A INTRINSIC
PHD 352 395 7.17e-15 SMART
RING 353 394 7.46e-1 SMART
low complexity region 411 430 N/A INTRINSIC
PHD 431 474 4.41e-15 SMART
RING 432 473 2.63e0 SMART
CHROMO 479 559 8.11e-17 SMART
CHROMO 600 657 1.98e-11 SMART
low complexity region 662 681 N/A INTRINSIC
DEXDc 702 914 2.73e-37 SMART
low complexity region 1031 1043 N/A INTRINSIC
HELICc 1060 1144 7.61e-27 SMART
DUF1087 1269 1333 5.56e-33 SMART
DUF1086 1346 1503 4.05e-108 SMART
low complexity region 1513 1527 N/A INTRINSIC
low complexity region 1547 1565 N/A INTRINSIC
low complexity region 1577 1620 N/A INTRINSIC
low complexity region 1622 1640 N/A INTRINSIC
low complexity region 1648 1661 N/A INTRINSIC
Pfam:CHDCT2 1714 1886 2.8e-98 PFAM
low complexity region 1890 1902 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204185
AA Change: S68P

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000145333
Gene: ENSMUSG00000038279
AA Change: S68P

DomainStartEndE-ValueType
low complexity region 41 57 N/A INTRINSIC
low complexity region 97 109 N/A INTRINSIC
Meta Mutation Damage Score 0.0610 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 98% (65/66)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele exhibit complete prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik C T 11: 58,422,804 A86V possibly damaging Het
9430097D07Rik A G 2: 32,574,428 probably benign Het
Actr5 T A 2: 158,635,363 D411E probably benign Het
Ang5 A G 14: 43,962,845 D122G probably benign Het
Atg9a A T 1: 75,186,060 probably null Het
C530008M17Rik G C 5: 76,657,834 probably benign Het
Dctd C T 8: 48,137,414 probably benign Het
Ddx11 G A 17: 66,147,722 V642M possibly damaging Het
Dis3l2 G A 1: 86,760,321 V100I probably benign Het
Echdc2 T C 4: 108,172,131 V111A probably benign Het
Egr1 A G 18: 34,863,658 T498A probably benign Het
Exosc3 T C 4: 45,317,702 K200R possibly damaging Het
Exosc8 T C 3: 54,729,223 D229G probably benign Het
Ext1 T A 15: 53,092,412 I430F probably damaging Het
Fbxw22 T C 9: 109,403,424 N31S probably benign Het
Gja8 T C 3: 96,919,849 T166A probably benign Het
Gm21814 T A 6: 149,583,618 noncoding transcript Het
Gm21915 T A 9: 40,670,648 H12Q probably benign Het
Gm597 A G 1: 28,777,862 I363T possibly damaging Het
Hgsnat G A 8: 25,947,960 R527* probably null Het
Iqgap2 A G 13: 95,673,743 F731S probably benign Het
Jchain T C 5: 88,522,505 H85R probably damaging Het
Kcnb2 T C 1: 15,312,962 C171R probably benign Het
Kcnk3 C A 5: 30,622,805 R400S possibly damaging Het
Klhl28 C T 12: 64,957,227 E171K probably damaging Het
Lrrfip2 T C 9: 111,223,972 I375T possibly damaging Het
Mccc1 T C 3: 35,979,017 N326S probably benign Het
Med13l T C 5: 118,593,550 V97A possibly damaging Het
Mertk C A 2: 128,784,000 T685K probably benign Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Myom2 G A 8: 15,083,310 V401M probably damaging Het
Nme5 A C 18: 34,578,685 M1R probably null Het
Notch1 A T 2: 26,476,114 D809E possibly damaging Het
Olfr292 T C 7: 86,694,585 I43T possibly damaging Het
Ppat C T 5: 76,928,678 probably benign Het
Prss23 T A 7: 89,510,214 M216L probably benign Het
Psg18 A T 7: 18,349,354 V171D probably damaging Het
Psg28 A G 7: 18,427,891 V229A probably damaging Het
Qser1 T C 2: 104,787,831 N879D possibly damaging Het
Rpap1 T C 2: 119,770,041 N879S probably benign Het
Rusc2 T C 4: 43,415,926 S411P probably damaging Het
Rxfp2 T A 5: 150,067,360 W519R probably damaging Het
Scpep1 T A 11: 88,941,349 Q185L probably benign Het
Serpinb11 A G 1: 107,379,649 N270S probably benign Het
Serpinb6d T A 13: 33,671,444 M367K probably benign Het
Skint10 T G 4: 112,727,672 I213L probably benign Het
Skint5 T C 4: 113,546,537 T1163A unknown Het
Slamf9 A T 1: 172,476,213 I42L possibly damaging Het
Slc1a3 T C 15: 8,650,846 probably benign Het
Smad6 T A 9: 63,953,900 Q371L possibly damaging Het
Snx31 A T 15: 36,555,324 V26E probably damaging Het
Taf4b A G 18: 14,822,172 N594S possibly damaging Het
Tanc2 T C 11: 105,780,092 S172P probably damaging Het
Tas2r110 T A 6: 132,868,475 Y156* probably null Het
Tbc1d20 G A 2: 152,293,936 probably benign Het
Timm50 A T 7: 28,306,859 D272E probably benign Het
Ttn T G 2: 76,900,511 probably benign Het
Vps13c T A 9: 67,916,379 F1362I probably benign Het
Vwf T C 6: 125,566,257 S154P probably benign Het
Zfp445 T C 9: 122,852,345 R844G probably benign Het
Other mutations in Nop2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00787:Nop2 APN 6 125133546 missense probably damaging 1.00
IGL00913:Nop2 APN 6 125139821 missense probably damaging 1.00
IGL02568:Nop2 APN 6 125140850 missense probably damaging 1.00
IGL02850:Nop2 APN 6 125144085 missense possibly damaging 0.67
IGL02850:Nop2 APN 6 125144070 missense probably benign 0.01
IGL02851:Nop2 APN 6 125144085 missense possibly damaging 0.67
IGL02851:Nop2 APN 6 125144070 missense probably benign 0.01
IGL03144:Nop2 APN 6 125137512 critical splice donor site probably null
IGL03338:Nop2 APN 6 125139732 splice site probably null
R0211:Nop2 UTSW 6 125141344 missense probably damaging 1.00
R0211:Nop2 UTSW 6 125141344 missense probably damaging 1.00
R0486:Nop2 UTSW 6 125140673 missense probably null 0.14
R0627:Nop2 UTSW 6 125139704 missense possibly damaging 0.90
R1022:Nop2 UTSW 6 125137186 missense probably benign 0.02
R1024:Nop2 UTSW 6 125137186 missense probably benign 0.02
R1068:Nop2 UTSW 6 125132279 missense probably damaging 0.99
R1750:Nop2 UTSW 6 125137638 missense probably benign 0.00
R1847:Nop2 UTSW 6 125137079 unclassified probably benign
R1940:Nop2 UTSW 6 125134634 missense probably benign 0.43
R1972:Nop2 UTSW 6 125134639 missense probably benign 0.02
R2059:Nop2 UTSW 6 125139860 missense probably null 0.95
R2100:Nop2 UTSW 6 125140822 missense probably damaging 1.00
R3123:Nop2 UTSW 6 125132201 utr 5 prime probably benign
R3124:Nop2 UTSW 6 125132201 utr 5 prime probably benign
R3160:Nop2 UTSW 6 125134592 missense probably benign 0.00
R3162:Nop2 UTSW 6 125134592 missense probably benign 0.00
R4521:Nop2 UTSW 6 125133552 missense probably damaging 1.00
R4522:Nop2 UTSW 6 125133552 missense probably damaging 1.00
R4523:Nop2 UTSW 6 125133552 missense probably damaging 1.00
R4524:Nop2 UTSW 6 125133552 missense probably damaging 1.00
R4571:Nop2 UTSW 6 125140881 critical splice donor site probably null
R4695:Nop2 UTSW 6 125144556 missense probably benign 0.00
R4747:Nop2 UTSW 6 125137094 missense probably benign
R5385:Nop2 UTSW 6 125144361 missense probably benign
R5455:Nop2 UTSW 6 125140643 missense probably benign 0.19
R5567:Nop2 UTSW 6 125133763 missense probably benign 0.00
R5914:Nop2 UTSW 6 125134728 missense probably benign 0.01
R5993:Nop2 UTSW 6 125144019 missense probably benign 0.00
R6031:Nop2 UTSW 6 125133566 critical splice donor site probably null
R6031:Nop2 UTSW 6 125133566 critical splice donor site probably null
R6065:Nop2 UTSW 6 125144565 missense probably benign
R6352:Nop2 UTSW 6 125137207 missense probably benign
R6436:Nop2 UTSW 6 125137311 missense probably benign 0.01
R7393:Nop2 UTSW 6 125133546 nonsense probably null
R7499:Nop2 UTSW 6 125144208 missense possibly damaging 0.75
R8029:Nop2 UTSW 6 125144420 missense possibly damaging 0.77
R8059:Nop2 UTSW 6 125140812 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GAGAATTCCAAGAGGCTGTCG -3'
(R):5'- CCTGAGCTATCTCCAGCATC -3'

Sequencing Primer
(F):5'- ATTCCAAGAGGCTGTCGAGTCG -3'
(R):5'- CCCAGAGGATTCTTCACA -3'
Posted On2016-06-06