Incidental Mutation 'R5010:Psg28'
ID390435
Institutional Source Beutler Lab
Gene Symbol Psg28
Ensembl Gene ENSMUSG00000030373
Gene Namepregnancy-specific glycoprotein 28
Synonyms
MMRRC Submission 042601-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R5010 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location18422536-18432041 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 18427891 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 229 (V229A)
Ref Sequence ENSEMBL: ENSMUSP00000019291 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019291]
Predicted Effect probably damaging
Transcript: ENSMUST00000019291
AA Change: V229A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019291
Gene: ENSMUSG00000030373
AA Change: V229A

DomainStartEndE-ValueType
IG 40 138 1.84e-2 SMART
IG 157 258 1.67e0 SMART
IG 277 376 1.65e-4 SMART
IGc2 394 458 8.31e-10 SMART
Meta Mutation Damage Score 0.3380 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 98% (65/66)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik C T 11: 58,422,804 A86V possibly damaging Het
9430097D07Rik A G 2: 32,574,428 probably benign Het
Actr5 T A 2: 158,635,363 D411E probably benign Het
Ang5 A G 14: 43,962,845 D122G probably benign Het
Atg9a A T 1: 75,186,060 probably null Het
C530008M17Rik G C 5: 76,657,834 probably benign Het
Dctd C T 8: 48,137,414 probably benign Het
Ddx11 G A 17: 66,147,722 V642M possibly damaging Het
Dis3l2 G A 1: 86,760,321 V100I probably benign Het
Echdc2 T C 4: 108,172,131 V111A probably benign Het
Egr1 A G 18: 34,863,658 T498A probably benign Het
Exosc3 T C 4: 45,317,702 K200R possibly damaging Het
Exosc8 T C 3: 54,729,223 D229G probably benign Het
Ext1 T A 15: 53,092,412 I430F probably damaging Het
Fbxw22 T C 9: 109,403,424 N31S probably benign Het
Gja8 T C 3: 96,919,849 T166A probably benign Het
Gm21814 T A 6: 149,583,618 noncoding transcript Het
Gm21915 T A 9: 40,670,648 H12Q probably benign Het
Gm597 A G 1: 28,777,862 I363T possibly damaging Het
Hgsnat G A 8: 25,947,960 R527* probably null Het
Iqgap2 A G 13: 95,673,743 F731S probably benign Het
Jchain T C 5: 88,522,505 H85R probably damaging Het
Kcnb2 T C 1: 15,312,962 C171R probably benign Het
Kcnk3 C A 5: 30,622,805 R400S possibly damaging Het
Klhl28 C T 12: 64,957,227 E171K probably damaging Het
Lrrfip2 T C 9: 111,223,972 I375T possibly damaging Het
Mccc1 T C 3: 35,979,017 N326S probably benign Het
Med13l T C 5: 118,593,550 V97A possibly damaging Het
Mertk C A 2: 128,784,000 T685K probably benign Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Myom2 G A 8: 15,083,310 V401M probably damaging Het
Nme5 A C 18: 34,578,685 M1R probably null Het
Nop2 T C 6: 125,133,763 S68P probably benign Het
Notch1 A T 2: 26,476,114 D809E possibly damaging Het
Olfr292 T C 7: 86,694,585 I43T possibly damaging Het
Ppat C T 5: 76,928,678 probably benign Het
Prss23 T A 7: 89,510,214 M216L probably benign Het
Psg18 A T 7: 18,349,354 V171D probably damaging Het
Qser1 T C 2: 104,787,831 N879D possibly damaging Het
Rpap1 T C 2: 119,770,041 N879S probably benign Het
Rusc2 T C 4: 43,415,926 S411P probably damaging Het
Rxfp2 T A 5: 150,067,360 W519R probably damaging Het
Scpep1 T A 11: 88,941,349 Q185L probably benign Het
Serpinb11 A G 1: 107,379,649 N270S probably benign Het
Serpinb6d T A 13: 33,671,444 M367K probably benign Het
Skint10 T G 4: 112,727,672 I213L probably benign Het
Skint5 T C 4: 113,546,537 T1163A unknown Het
Slamf9 A T 1: 172,476,213 I42L possibly damaging Het
Slc1a3 T C 15: 8,650,846 probably benign Het
Smad6 T A 9: 63,953,900 Q371L possibly damaging Het
Snx31 A T 15: 36,555,324 V26E probably damaging Het
Taf4b A G 18: 14,822,172 N594S possibly damaging Het
Tanc2 T C 11: 105,780,092 S172P probably damaging Het
Tas2r110 T A 6: 132,868,475 Y156* probably null Het
Tbc1d20 G A 2: 152,293,936 probably benign Het
Timm50 A T 7: 28,306,859 D272E probably benign Het
Ttn T G 2: 76,900,511 probably benign Het
Vps13c T A 9: 67,916,379 F1362I probably benign Het
Vwf T C 6: 125,566,257 S154P probably benign Het
Zfp445 T C 9: 122,852,345 R844G probably benign Het
Other mutations in Psg28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00673:Psg28 APN 7 18427891 missense probably damaging 1.00
IGL01118:Psg28 APN 7 18428092 missense probably damaging 1.00
IGL01606:Psg28 APN 7 18430371 missense probably benign 0.01
R0276:Psg28 UTSW 7 18430396 missense probably benign 0.00
R0391:Psg28 UTSW 7 18426173 missense probably benign 0.02
R0713:Psg28 UTSW 7 18423074 missense possibly damaging 0.61
R1454:Psg28 UTSW 7 18427964 missense possibly damaging 0.50
R1725:Psg28 UTSW 7 18428011 missense possibly damaging 0.67
R2176:Psg28 UTSW 7 18427879 missense probably damaging 1.00
R3154:Psg28 UTSW 7 18426423 missense possibly damaging 0.91
R4520:Psg28 UTSW 7 18422901 missense probably benign 0.00
R5529:Psg28 UTSW 7 18430448 missense probably benign 0.15
R5772:Psg28 UTSW 7 18430715 missense probably damaging 1.00
R6039:Psg28 UTSW 7 18426182 missense possibly damaging 0.82
R6039:Psg28 UTSW 7 18426182 missense possibly damaging 0.82
R6046:Psg28 UTSW 7 18426380 missense probably damaging 1.00
R6275:Psg28 UTSW 7 18430440 missense probably damaging 1.00
R6586:Psg28 UTSW 7 18430544 missense probably damaging 0.99
R6928:Psg28 UTSW 7 18423078 missense possibly damaging 0.80
R7197:Psg28 UTSW 7 18430584 missense probably damaging 1.00
R7237:Psg28 UTSW 7 18427844 missense possibly damaging 0.65
R7859:Psg28 UTSW 7 18426224 missense probably damaging 1.00
R7863:Psg28 UTSW 7 18428117 missense possibly damaging 0.62
R7993:Psg28 UTSW 7 18426476 missense possibly damaging 0.63
R8009:Psg28 UTSW 7 18422997 missense probably damaging 0.96
R8115:Psg28 UTSW 7 18430386 missense probably benign 0.15
R8247:Psg28 UTSW 7 18422939 missense probably benign 0.01
RF016:Psg28 UTSW 7 18422922 missense probably damaging 0.97
X0020:Psg28 UTSW 7 18427939 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GGAGGTAGTCACATGTCAGCAG -3'
(R):5'- CCCACTATTGAATTAGTGCCGAC -3'

Sequencing Primer
(F):5'- CAGTGACAGTGCTCTTGGTAGAAG -3'
(R):5'- CTATTGAATTAGTGCCGACCAGCG -3'
Posted On2016-06-06