Incidental Mutation 'R5010:Timm50'
ID390436
Institutional Source Beutler Lab
Gene Symbol Timm50
Ensembl Gene ENSMUSG00000003438
Gene Nametranslocase of inner mitochondrial membrane 50
SynonymsTIM50L, 2810403L02Rik
MMRRC Submission 042601-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5010 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location28305516-28312072 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 28306859 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 272 (D272E)
Ref Sequence ENSEMBL: ENSMUSP00000080614 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081946] [ENSMUST00000108315]
Predicted Effect probably benign
Transcript: ENSMUST00000081946
AA Change: D272E

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000080614
Gene: ENSMUSG00000003438
AA Change: D272E

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
transmembrane domain 66 88 N/A INTRINSIC
CPDc 146 274 1.33e-41 SMART
low complexity region 313 330 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108315
SMART Domains Protein: ENSMUSP00000103951
Gene: ENSMUSG00000003436

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Blast:EGF 60 118 3e-18 BLAST
low complexity region 140 154 N/A INTRINSIC
low complexity region 183 198 N/A INTRINSIC
EGF 211 247 1.53e1 SMART
EGF 275 308 3.08e-6 SMART
EGF 313 349 8.25e-7 SMART
EGF 354 387 2.83e-5 SMART
EGF 392 425 1.04e-3 SMART
EGF 430 463 7.07e-6 SMART
transmembrane domain 489 511 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131849
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134263
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135220
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136427
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151990
Meta Mutation Damage Score 0.0962 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the TIM23 inner mitochondrial membrane translocase complex. The encoded protein functions as the receptor subunit that recognizes the mitochondrial targeting signal, or presequence, on protein cargo that is destined for the mitochondrial inner membrane and matrix. This protein may also play a role in maintaining the membrane permeability barrier, and knockdown of this gene in human cells results in the release of cytochrome c and apoptosis. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik C T 11: 58,422,804 A86V possibly damaging Het
9430097D07Rik A G 2: 32,574,428 probably benign Het
Actr5 T A 2: 158,635,363 D411E probably benign Het
Ang5 A G 14: 43,962,845 D122G probably benign Het
Atg9a A T 1: 75,186,060 probably null Het
C530008M17Rik G C 5: 76,657,834 probably benign Het
Dctd C T 8: 48,137,414 probably benign Het
Ddx11 G A 17: 66,147,722 V642M possibly damaging Het
Dis3l2 G A 1: 86,760,321 V100I probably benign Het
Echdc2 T C 4: 108,172,131 V111A probably benign Het
Egr1 A G 18: 34,863,658 T498A probably benign Het
Exosc3 T C 4: 45,317,702 K200R possibly damaging Het
Exosc8 T C 3: 54,729,223 D229G probably benign Het
Ext1 T A 15: 53,092,412 I430F probably damaging Het
Fbxw22 T C 9: 109,403,424 N31S probably benign Het
Gja8 T C 3: 96,919,849 T166A probably benign Het
Gm21814 T A 6: 149,583,618 noncoding transcript Het
Gm21915 T A 9: 40,670,648 H12Q probably benign Het
Gm597 A G 1: 28,777,862 I363T possibly damaging Het
Hgsnat G A 8: 25,947,960 R527* probably null Het
Iqgap2 A G 13: 95,673,743 F731S probably benign Het
Jchain T C 5: 88,522,505 H85R probably damaging Het
Kcnb2 T C 1: 15,312,962 C171R probably benign Het
Kcnk3 C A 5: 30,622,805 R400S possibly damaging Het
Klhl28 C T 12: 64,957,227 E171K probably damaging Het
Lrrfip2 T C 9: 111,223,972 I375T possibly damaging Het
Mccc1 T C 3: 35,979,017 N326S probably benign Het
Med13l T C 5: 118,593,550 V97A possibly damaging Het
Mertk C A 2: 128,784,000 T685K probably benign Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Myom2 G A 8: 15,083,310 V401M probably damaging Het
Nme5 A C 18: 34,578,685 M1R probably null Het
Nop2 T C 6: 125,133,763 S68P probably benign Het
Notch1 A T 2: 26,476,114 D809E possibly damaging Het
Olfr292 T C 7: 86,694,585 I43T possibly damaging Het
Ppat C T 5: 76,928,678 probably benign Het
Prss23 T A 7: 89,510,214 M216L probably benign Het
Psg18 A T 7: 18,349,354 V171D probably damaging Het
Psg28 A G 7: 18,427,891 V229A probably damaging Het
Qser1 T C 2: 104,787,831 N879D possibly damaging Het
Rpap1 T C 2: 119,770,041 N879S probably benign Het
Rusc2 T C 4: 43,415,926 S411P probably damaging Het
Rxfp2 T A 5: 150,067,360 W519R probably damaging Het
Scpep1 T A 11: 88,941,349 Q185L probably benign Het
Serpinb11 A G 1: 107,379,649 N270S probably benign Het
Serpinb6d T A 13: 33,671,444 M367K probably benign Het
Skint10 T G 4: 112,727,672 I213L probably benign Het
Skint5 T C 4: 113,546,537 T1163A unknown Het
Slamf9 A T 1: 172,476,213 I42L possibly damaging Het
Slc1a3 T C 15: 8,650,846 probably benign Het
Smad6 T A 9: 63,953,900 Q371L possibly damaging Het
Snx31 A T 15: 36,555,324 V26E probably damaging Het
Taf4b A G 18: 14,822,172 N594S possibly damaging Het
Tanc2 T C 11: 105,780,092 S172P probably damaging Het
Tas2r110 T A 6: 132,868,475 Y156* probably null Het
Tbc1d20 G A 2: 152,293,936 probably benign Het
Ttn T G 2: 76,900,511 probably benign Het
Vps13c T A 9: 67,916,379 F1362I probably benign Het
Vwf T C 6: 125,566,257 S154P probably benign Het
Zfp445 T C 9: 122,852,345 R844G probably benign Het
Other mutations in Timm50
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0402:Timm50 UTSW 7 28306855 missense probably damaging 1.00
R0709:Timm50 UTSW 7 28306941 missense probably damaging 1.00
R3881:Timm50 UTSW 7 28311007 missense probably benign
R4604:Timm50 UTSW 7 28311018 missense probably benign
R4947:Timm50 UTSW 7 28310044 unclassified probably benign
R5359:Timm50 UTSW 7 28308167 missense probably damaging 1.00
R6866:Timm50 UTSW 7 28305945 missense probably damaging 1.00
R8033:Timm50 UTSW 7 28306833 missense possibly damaging 0.50
R8242:Timm50 UTSW 7 28308411 missense probably benign 0.06
Z1177:Timm50 UTSW 7 28307568 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCAGAAAGTTCCAGAAGGCTC -3'
(R):5'- ATCTGGGAGTCTTTGCAAGGC -3'

Sequencing Primer
(F):5'- GTTCCAGAAGGCTCCAGGATACTC -3'
(R):5'- AGTCTTTGCAAGGCACGTC -3'
Posted On2016-06-06