Incidental Mutation 'R5010:Hgsnat'
ID390440
Institutional Source Beutler Lab
Gene Symbol Hgsnat
Ensembl Gene ENSMUSG00000037260
Gene Nameheparan-alpha-glucosaminide N-acetyltransferase
SynonymsD8Ertd354e, 9430010M12Rik, Tmem76
MMRRC Submission 042601-MU
Accession Numbers

Ncbi RefSeq: NM_029884.1; MGI:1196297

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5010 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location25944453-25976753 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 25947960 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 527 (R527*)
Ref Sequence ENSEMBL: ENSMUSP00000040356 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037609]
Predicted Effect probably null
Transcript: ENSMUST00000037609
AA Change: R527*
SMART Domains Protein: ENSMUSP00000040356
Gene: ENSMUSG00000037260
AA Change: R527*

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
transmembrane domain 33 55 N/A INTRINSIC
transmembrane domain 189 211 N/A INTRINSIC
Pfam:DUF1624 260 434 6.8e-11 PFAM
Pfam:DUF5009 286 389 2.4e-10 PFAM
transmembrane domain 494 516 N/A INTRINSIC
transmembrane domain 523 545 N/A INTRINSIC
transmembrane domain 560 582 N/A INTRINSIC
transmembrane domain 587 609 N/A INTRINSIC
transmembrane domain 629 648 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210894
Meta Mutation Damage Score 0.9700 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a lysosomal acetyltransferase, which is one of several enzymes involved in the lysosomal degradation of heparin sulfate. Mutations in this gene are associated with Sanfilippo syndrome C, one type of the lysosomal storage disease mucopolysaccaridosis III, which results from impaired degradation of heparan sulfate. [provided by RefSeq, Jan 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit progressive storage pathology in the CNS and peripheral organs, glycosaminoglycan accumulation in brain and most somatic organs, lysosomal distension and dysfunction, astrocytosis, microgliosis, hepatosplenomegaly, behavioral deficits and premature death. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted(3) Gene trapped(6)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik C T 11: 58,422,804 A86V possibly damaging Het
9430097D07Rik A G 2: 32,574,428 probably benign Het
Actr5 T A 2: 158,635,363 D411E probably benign Het
Ang5 A G 14: 43,962,845 D122G probably benign Het
Atg9a A T 1: 75,186,060 probably null Het
C530008M17Rik G C 5: 76,657,834 probably benign Het
Dctd C T 8: 48,137,414 probably benign Het
Ddx11 G A 17: 66,147,722 V642M possibly damaging Het
Dis3l2 G A 1: 86,760,321 V100I probably benign Het
Echdc2 T C 4: 108,172,131 V111A probably benign Het
Egr1 A G 18: 34,863,658 T498A probably benign Het
Exosc3 T C 4: 45,317,702 K200R possibly damaging Het
Exosc8 T C 3: 54,729,223 D229G probably benign Het
Ext1 T A 15: 53,092,412 I430F probably damaging Het
Fbxw22 T C 9: 109,403,424 N31S probably benign Het
Gja8 T C 3: 96,919,849 T166A probably benign Het
Gm21814 T A 6: 149,583,618 noncoding transcript Het
Gm21915 T A 9: 40,670,648 H12Q probably benign Het
Gm597 A G 1: 28,777,862 I363T possibly damaging Het
Iqgap2 A G 13: 95,673,743 F731S probably benign Het
Jchain T C 5: 88,522,505 H85R probably damaging Het
Kcnb2 T C 1: 15,312,962 C171R probably benign Het
Kcnk3 C A 5: 30,622,805 R400S possibly damaging Het
Klhl28 C T 12: 64,957,227 E171K probably damaging Het
Lrrfip2 T C 9: 111,223,972 I375T possibly damaging Het
Mccc1 T C 3: 35,979,017 N326S probably benign Het
Med13l T C 5: 118,593,550 V97A possibly damaging Het
Mertk C A 2: 128,784,000 T685K probably benign Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Myom2 G A 8: 15,083,310 V401M probably damaging Het
Nme5 A C 18: 34,578,685 M1R probably null Het
Nop2 T C 6: 125,133,763 S68P probably benign Het
Notch1 A T 2: 26,476,114 D809E possibly damaging Het
Olfr292 T C 7: 86,694,585 I43T possibly damaging Het
Ppat C T 5: 76,928,678 probably benign Het
Prss23 T A 7: 89,510,214 M216L probably benign Het
Psg18 A T 7: 18,349,354 V171D probably damaging Het
Psg28 A G 7: 18,427,891 V229A probably damaging Het
Qser1 T C 2: 104,787,831 N879D possibly damaging Het
Rpap1 T C 2: 119,770,041 N879S probably benign Het
Rusc2 T C 4: 43,415,926 S411P probably damaging Het
Rxfp2 T A 5: 150,067,360 W519R probably damaging Het
Scpep1 T A 11: 88,941,349 Q185L probably benign Het
Serpinb11 A G 1: 107,379,649 N270S probably benign Het
Serpinb6d T A 13: 33,671,444 M367K probably benign Het
Skint10 T G 4: 112,727,672 I213L probably benign Het
Skint5 T C 4: 113,546,537 T1163A unknown Het
Slamf9 A T 1: 172,476,213 I42L possibly damaging Het
Slc1a3 T C 15: 8,650,846 probably benign Het
Smad6 T A 9: 63,953,900 Q371L possibly damaging Het
Snx31 A T 15: 36,555,324 V26E probably damaging Het
Taf4b A G 18: 14,822,172 N594S possibly damaging Het
Tanc2 T C 11: 105,780,092 S172P probably damaging Het
Tas2r110 T A 6: 132,868,475 Y156* probably null Het
Tbc1d20 G A 2: 152,293,936 probably benign Het
Timm50 A T 7: 28,306,859 D272E probably benign Het
Ttn T G 2: 76,900,511 probably benign Het
Vps13c T A 9: 67,916,379 F1362I probably benign Het
Vwf T C 6: 125,566,257 S154P probably benign Het
Zfp445 T C 9: 122,852,345 R844G probably benign Het
Other mutations in Hgsnat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00661:Hgsnat APN 8 25972937 missense probably benign 0.04
IGL02950:Hgsnat APN 8 25971701 missense probably damaging 1.00
IGL03145:Hgsnat APN 8 25946452 missense probably damaging 1.00
ample UTSW 8 25947960 nonsense probably null
generous UTSW 8 25968361 critical splice donor site probably null
P0018:Hgsnat UTSW 8 25968354 unclassified probably benign
PIT4305001:Hgsnat UTSW 8 25945199 missense possibly damaging 0.67
R1396:Hgsnat UTSW 8 25957335 missense possibly damaging 0.95
R1676:Hgsnat UTSW 8 25954605 critical splice donor site probably null
R1856:Hgsnat UTSW 8 25957256 missense probably benign 0.06
R1998:Hgsnat UTSW 8 25945252 nonsense probably null
R2497:Hgsnat UTSW 8 25945252 nonsense probably null
R2570:Hgsnat UTSW 8 25945252 nonsense probably null
R4012:Hgsnat UTSW 8 25955789 nonsense probably null
R4080:Hgsnat UTSW 8 25946343 missense probably benign 0.02
R4462:Hgsnat UTSW 8 25954636 missense probably damaging 1.00
R4523:Hgsnat UTSW 8 25968361 critical splice donor site probably null
R4914:Hgsnat UTSW 8 25964838 missense probably damaging 0.98
R5561:Hgsnat UTSW 8 25946334 missense possibly damaging 0.90
R5889:Hgsnat UTSW 8 25963367 missense probably damaging 1.00
R6411:Hgsnat UTSW 8 25946275 missense possibly damaging 0.88
R6520:Hgsnat UTSW 8 25953300 missense probably damaging 1.00
R6524:Hgsnat UTSW 8 25945232 missense probably damaging 1.00
R7230:Hgsnat UTSW 8 25954832 splice site probably null
R7462:Hgsnat UTSW 8 25957213 missense probably benign 0.45
R7509:Hgsnat UTSW 8 25955726 missense probably damaging 0.98
R7526:Hgsnat UTSW 8 25971049 missense probably damaging 1.00
R7583:Hgsnat UTSW 8 25971564 critical splice donor site probably null
R7679:Hgsnat UTSW 8 25954637 missense probably damaging 1.00
R8111:Hgsnat UTSW 8 25968412 missense probably benign 0.00
R8206:Hgsnat UTSW 8 25954637 missense probably damaging 1.00
R8321:Hgsnat UTSW 8 25971151 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TGGCTTTAAGAATAGCAATCGGGG -3'
(R):5'- TCCCCAGAGTCTAGAACGTG -3'

Sequencing Primer
(F):5'- ACAGACTGCTCTTTCGAAGG -3'
(R):5'- CCCAGAGTCTAGAACGTGTACTTAG -3'
Posted On2016-06-06