Mutagenetix > Incidental Mutation

Incidental Mutation 'R5010:Tanc2'

390451

Institutional Source

Beutler Lab

Gene Symbol

Tanc2

Ensembl Gene

ENSMUSG00000053580

Gene Name

tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2

Synonyms

5730590C14Rik, 3526402J09Rik

MMRRC Submission

042601-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5010 (G1)

Quality Score

183

Status

Validated

Chromosome

Chromosomal Location

105589986-105929304 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 105780092 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 172 (S172P)

Ref Sequence

ENSEMBL: ENSMUSP00000097904 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000100330] [ENSMUST00000168598] [ENSMUST00000207807]

AlphaFold

A2A690

Predicted Effect

probably damaging
Transcript: ENSMUST00000100330
AA Change: S172P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000097904
Gene: ENSMUSG00000053580
AA Change: S172P

Domain	Start	End	E-Value	Type
low complexity region	32	50	N/A	INTRINSIC
low complexity region	129	152	N/A	INTRINSIC
low complexity region	362	375	N/A	INTRINSIC
low complexity region	436	447	N/A	INTRINSIC
low complexity region	823	834	N/A	INTRINSIC
ANK	846	878	2.08e3	SMART
ANK	882	913	2.97e2	SMART
ANK	917	946	5.75e-1	SMART
ANK	950	979	8.62e1	SMART
ANK	990	1018	1.16e3	SMART
ANK	1033	1062	3.31e-1	SMART
ANK	1066	1095	7.71e-2	SMART
ANK	1099	1128	6.12e-5	SMART
ANK	1132	1161	8.99e-3	SMART
ANK	1165	1194	5.71e-5	SMART
ANK	1198	1227	2.11e2	SMART
TPR	1244	1277	3.89e1	SMART
TPR	1291	1324	3.61e-2	SMART
TPR	1325	1358	2.82e-4	SMART
low complexity region	1369	1406	N/A	INTRINSIC
low complexity region	1533	1539	N/A	INTRINSIC
low complexity region	1787	1802	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000168598

SMART Domains

Protein: ENSMUSP00000129877
Gene: ENSMUSG00000053580

Domain	Start	End	E-Value	Type
low complexity region	32	50	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000207807

Meta Mutation Damage Score

0.1688

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.6%

Validation Efficiency

98% (65/66)

MGI Phenotype

PHENOTYPE: Mice homozygous for a gene trap vector die prior to E12. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810065E05Rik	C	T	11: 58,422,804	A86V	possibly damaging	Het
9430097D07Rik	A	G	2: 32,574,428		probably benign	Het
Actr5	T	A	2: 158,635,363	D411E	probably benign	Het
Ang5	A	G	14: 43,962,845	D122G	probably benign	Het
Atg9a	A	T	1: 75,186,060		probably null	Het
C530008M17Rik	G	C	5: 76,657,834		probably benign	Het
Dctd	C	T	8: 48,137,414		probably benign	Het
Ddx11	G	A	17: 66,147,722	V642M	possibly damaging	Het
Dis3l2	G	A	1: 86,760,321	V100I	probably benign	Het
Echdc2	T	C	4: 108,172,131	V111A	probably benign	Het
Egr1	A	G	18: 34,863,658	T498A	probably benign	Het
Exosc3	T	C	4: 45,317,702	K200R	possibly damaging	Het
Exosc8	T	C	3: 54,729,223	D229G	probably benign	Het
Ext1	T	A	15: 53,092,412	I430F	probably damaging	Het
Fbxw22	T	C	9: 109,403,424	N31S	probably benign	Het
Gja8	T	C	3: 96,919,849	T166A	probably benign	Het
Gm21814	T	A	6: 149,583,618		noncoding transcript	Het
Gm21915	T	A	9: 40,670,648	H12Q	probably benign	Het
Gm597	A	G	1: 28,777,862	I363T	possibly damaging	Het
Hgsnat	G	A	8: 25,947,960	R527*	probably null	Het
Iqgap2	A	G	13: 95,673,743	F731S	probably benign	Het
Jchain	T	C	5: 88,522,505	H85R	probably damaging	Het
Kcnb2	T	C	1: 15,312,962	C171R	probably benign	Het
Kcnk3	C	A	5: 30,622,805	R400S	possibly damaging	Het
Klhl28	C	T	12: 64,957,227	E171K	probably damaging	Het
Lrrfip2	T	C	9: 111,223,972	I375T	possibly damaging	Het
Mccc1	T	C	3: 35,979,017	N326S	probably benign	Het
Med13l	T	C	5: 118,593,550	V97A	possibly damaging	Het
Mertk	C	A	2: 128,784,000	T685K	probably benign	Het
Msh2	C	A	17: 87,723,413	A906E	probably benign	Het
Myom2	G	A	8: 15,083,310	V401M	probably damaging	Het
Nme5	A	C	18: 34,578,685	M1R	probably null	Het
Nop2	T	C	6: 125,133,763	S68P	probably benign	Het
Notch1	A	T	2: 26,476,114	D809E	possibly damaging	Het
Olfr292	T	C	7: 86,694,585	I43T	possibly damaging	Het
Ppat	C	T	5: 76,928,678		probably benign	Het
Prss23	T	A	7: 89,510,214	M216L	probably benign	Het
Psg18	A	T	7: 18,349,354	V171D	probably damaging	Het
Psg28	A	G	7: 18,427,891	V229A	probably damaging	Het
Qser1	T	C	2: 104,787,831	N879D	possibly damaging	Het
Rpap1	T	C	2: 119,770,041	N879S	probably benign	Het
Rusc2	T	C	4: 43,415,926	S411P	probably damaging	Het
Rxfp2	T	A	5: 150,067,360	W519R	probably damaging	Het
Scpep1	T	A	11: 88,941,349	Q185L	probably benign	Het
Serpinb11	A	G	1: 107,379,649	N270S	probably benign	Het
Serpinb6d	T	A	13: 33,671,444	M367K	probably benign	Het
Skint10	T	G	4: 112,727,672	I213L	probably benign	Het
Skint5	T	C	4: 113,546,537	T1163A	unknown	Het
Slamf9	A	T	1: 172,476,213	I42L	possibly damaging	Het
Slc1a3	T	C	15: 8,650,846		probably benign	Het
Smad6	T	A	9: 63,953,900	Q371L	possibly damaging	Het
Snx31	A	T	15: 36,555,324	V26E	probably damaging	Het
Taf4b	A	G	18: 14,822,172	N594S	possibly damaging	Het
Tas2r110	T	A	6: 132,868,475	Y156*	probably null	Het
Tbc1d20	G	A	2: 152,293,936		probably benign	Het
Timm50	A	T	7: 28,306,859	D272E	probably benign	Het
Ttn	T	G	2: 76,900,511		probably benign	Het
Vps13c	T	A	9: 67,916,379	F1362I	probably benign	Het
Vwf	T	C	6: 125,566,257	S154P	probably benign	Het
Zfp445	T	C	9: 122,852,345	R844G	probably benign	Het

Other mutations in Tanc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00501:Tanc2	APN	11	105923220	missense	probably benign	0.28
IGL00688:Tanc2	APN	11	105798690	missense	probably damaging	1.00
IGL00709:Tanc2	APN	11	105798795	missense	probably damaging	1.00
IGL01013:Tanc2	APN	11	105625065	missense	probably damaging	0.96
IGL01141:Tanc2	APN	11	105886474	splice site	probably benign
IGL01386:Tanc2	APN	11	105886381	missense	probably damaging	0.99
IGL01433:Tanc2	APN	11	105810522	missense	possibly damaging	0.75
IGL01562:Tanc2	APN	11	105780069	missense	probably benign	0.00
IGL01979:Tanc2	APN	11	105776920	missense	probably benign
IGL02104:Tanc2	APN	11	105780133	unclassified	probably benign
IGL02434:Tanc2	APN	11	105780042	missense	probably benign	0.14
IGL02534:Tanc2	APN	11	105835168	missense	probably damaging	1.00
IGL02568:Tanc2	APN	11	105776951	missense	probably benign	0.00
IGL03279:Tanc2	APN	11	105913092	splice site	probably null
R0595:Tanc2	UTSW	11	105714177	splice site	probably null
R1131:Tanc2	UTSW	11	105835002	missense	probably damaging	1.00
R1320:Tanc2	UTSW	11	105886444	missense	probably damaging	1.00
R1487:Tanc2	UTSW	11	105923634	missense	probably damaging	0.99
R1497:Tanc2	UTSW	11	105922137	missense	probably benign	0.21
R1692:Tanc2	UTSW	11	105857500	missense	probably benign
R1712:Tanc2	UTSW	11	105899780	missense	probably benign
R1793:Tanc2	UTSW	11	105625033	critical splice acceptor site	probably null
R1812:Tanc2	UTSW	11	105886386	missense	probably benign	0.01
R1905:Tanc2	UTSW	11	105922863	missense	possibly damaging	0.61
R1959:Tanc2	UTSW	11	105910295	missense	probably damaging	1.00
R1962:Tanc2	UTSW	11	105798732	missense	probably benign	0.14
R2122:Tanc2	UTSW	11	105895949	missense	probably damaging	1.00
R2174:Tanc2	UTSW	11	105910309	missense	probably benign	0.00
R2341:Tanc2	UTSW	11	105835051	missense	probably benign	0.09
R2497:Tanc2	UTSW	11	105673493	critical splice donor site	probably null
R3438:Tanc2	UTSW	11	105857575	missense	probably damaging	0.97
R3711:Tanc2	UTSW	11	105798690	missense	probably damaging	1.00
R3765:Tanc2	UTSW	11	105914970	missense	probably damaging	1.00
R3890:Tanc2	UTSW	11	105798678	missense	probably damaging	1.00
R4193:Tanc2	UTSW	11	105914062	intron	probably benign
R4609:Tanc2	UTSW	11	105910240	missense	probably benign	0.24
R4674:Tanc2	UTSW	11	105867480	missense	probably damaging	1.00
R4928:Tanc2	UTSW	11	105867762	missense	probably damaging	1.00
R5008:Tanc2	UTSW	11	105625060	start codon destroyed	probably null	0.46
R5135:Tanc2	UTSW	11	105857553	missense	possibly damaging	0.93
R5385:Tanc2	UTSW	11	105776846	missense	probably damaging	0.99
R5409:Tanc2	UTSW	11	105867485	missense	possibly damaging	0.93
R5419:Tanc2	UTSW	11	105922883	missense	probably benign	0.00
R5501:Tanc2	UTSW	11	105914985	critical splice donor site	probably null
R5590:Tanc2	UTSW	11	105923306	missense	probably damaging	0.99
R5651:Tanc2	UTSW	11	105798700	missense	probably benign	0.44
R5798:Tanc2	UTSW	11	105921855	small deletion	probably benign
R5876:Tanc2	UTSW	11	105922613	missense	possibly damaging	0.71
R5889:Tanc2	UTSW	11	105921807	missense	probably benign	0.23
R5958:Tanc2	UTSW	11	105840625	missense	probably benign	0.00
R5999:Tanc2	UTSW	11	105867717	missense	probably damaging	1.00
R6024:Tanc2	UTSW	11	105867717	missense	probably damaging	1.00
R6024:Tanc2	UTSW	11	105923672	missense	probably damaging	1.00
R6025:Tanc2	UTSW	11	105867717	missense	probably damaging	1.00
R6025:Tanc2	UTSW	11	105896547	missense	possibly damaging	0.68
R6048:Tanc2	UTSW	11	105867717	missense	probably damaging	1.00
R6049:Tanc2	UTSW	11	105867717	missense	probably damaging	1.00
R6185:Tanc2	UTSW	11	105913039	missense	probably damaging	1.00
R6335:Tanc2	UTSW	11	105857556	missense	probably damaging	0.99
R6821:Tanc2	UTSW	11	105886490	splice site	probably null
R6846:Tanc2	UTSW	11	105798653	missense	probably benign	0.34
R6857:Tanc2	UTSW	11	105910288	missense	possibly damaging	0.81
R6904:Tanc2	UTSW	11	105835230	missense	possibly damaging	0.89
R7009:Tanc2	UTSW	11	105840699	missense	possibly damaging	0.47
R7017:Tanc2	UTSW	11	105923108	missense	probably benign
R7371:Tanc2	UTSW	11	105798596	missense	probably benign
R7556:Tanc2	UTSW	11	105909031	missense
R7630:Tanc2	UTSW	11	105776908	missense	probably benign	0.04
R7693:Tanc2	UTSW	11	105923467	missense	probably damaging	1.00
R7757:Tanc2	UTSW	11	105776858	missense	possibly damaging	0.81
R7807:Tanc2	UTSW	11	105867654	missense	probably benign	0.00
R7878:Tanc2	UTSW	11	105913415	missense
R7895:Tanc2	UTSW	11	105921825	missense	probably damaging	1.00
R7952:Tanc2	UTSW	11	105896597	missense	probably damaging	1.00
R8099:Tanc2	UTSW	11	105864007	missense	probably benign	0.17
R8117:Tanc2	UTSW	11	105835162	missense	probably damaging	1.00
R8133:Tanc2	UTSW	11	105923222	missense	probably damaging	0.97
R8422:Tanc2	UTSW	11	105835188	missense	probably benign	0.10
R8527:Tanc2	UTSW	11	105917008	missense	probably damaging	0.96
R8542:Tanc2	UTSW	11	105917008	missense	probably damaging	0.96
R8834:Tanc2	UTSW	11	105917019	missense
R8912:Tanc2	UTSW	11	105867327	missense	probably benign	0.01
R8927:Tanc2	UTSW	11	105810505	missense	probably damaging	0.99
R8928:Tanc2	UTSW	11	105810505	missense	probably damaging	0.99
R8968:Tanc2	UTSW	11	105867574	missense	possibly damaging	0.50
R9065:Tanc2	UTSW	11	105798692	nonsense	probably null
R9095:Tanc2	UTSW	11	105867278	missense	probably benign	0.00
R9108:Tanc2	UTSW	11	105919754	intron	probably benign
R9131:Tanc2	UTSW	11	105798777	missense	probably benign
R9294:Tanc2	UTSW	11	105886458	missense	probably damaging	0.99
R9445:Tanc2	UTSW	11	105867464	missense	possibly damaging	0.80
X0027:Tanc2	UTSW	11	105835183	missense	probably benign	0.26

Predicted Primers

PCR Primer
(F):5'- AACAGTTGTAAAGGCCTTATGGTG -3'
(R):5'- TGTTGGCTGTTATCAATTCAGC -3'

Sequencing Primer
(F):5'- GCCTTGAGATACATCTGAACAGTG -3'
(R):5'- CTGTGAAAACCTTACACCTAT -3'

Posted On

2016-06-06