Incidental Mutation 'R5010:Serpinb6d'
ID390453
Institutional Source Beutler Lab
Gene Symbol Serpinb6d
Ensembl Gene ENSMUSG00000047889
Gene Nameserine (or cysteine) peptidase inhibitor, clade B, member 6d
SynonymsSPI3D, Gm11390
MMRRC Submission 042601-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R5010 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location33661405-33671581 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 33671444 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 367 (M367K)
Ref Sequence ENSEMBL: ENSMUSP00000152621 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059637] [ENSMUST00000221681]
Predicted Effect probably benign
Transcript: ENSMUST00000059637
AA Change: M367K

PolyPhen 2 Score 0.154 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000063025
Gene: ENSMUSG00000047889
AA Change: M367K

DomainStartEndE-ValueType
SERPIN 13 375 1.67e-144 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000221681
AA Change: M367K

PolyPhen 2 Score 0.154 (Sensitivity: 0.92; Specificity: 0.87)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: This gene is a member of the large Serpin gene family. Many members of this family act as protease inhibitors, and have a conserved structure including a reactive center loop (RCL) that can act as a bait for protease targets. Unlike some members of this large gene family, the protein encoded by this gene is an intracellular protein, and lacks an N-terminal signal peptide sequence. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 13. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik C T 11: 58,422,804 A86V possibly damaging Het
9430097D07Rik A G 2: 32,574,428 probably benign Het
Actr5 T A 2: 158,635,363 D411E probably benign Het
Ang5 A G 14: 43,962,845 D122G probably benign Het
Atg9a A T 1: 75,186,060 probably null Het
C530008M17Rik G C 5: 76,657,834 probably benign Het
Dctd C T 8: 48,137,414 probably benign Het
Ddx11 G A 17: 66,147,722 V642M possibly damaging Het
Dis3l2 G A 1: 86,760,321 V100I probably benign Het
Echdc2 T C 4: 108,172,131 V111A probably benign Het
Egr1 A G 18: 34,863,658 T498A probably benign Het
Exosc3 T C 4: 45,317,702 K200R possibly damaging Het
Exosc8 T C 3: 54,729,223 D229G probably benign Het
Ext1 T A 15: 53,092,412 I430F probably damaging Het
Fbxw22 T C 9: 109,403,424 N31S probably benign Het
Gja8 T C 3: 96,919,849 T166A probably benign Het
Gm21814 T A 6: 149,583,618 noncoding transcript Het
Gm21915 T A 9: 40,670,648 H12Q probably benign Het
Gm597 A G 1: 28,777,862 I363T possibly damaging Het
Hgsnat G A 8: 25,947,960 R527* probably null Het
Iqgap2 A G 13: 95,673,743 F731S probably benign Het
Jchain T C 5: 88,522,505 H85R probably damaging Het
Kcnb2 T C 1: 15,312,962 C171R probably benign Het
Kcnk3 C A 5: 30,622,805 R400S possibly damaging Het
Klhl28 C T 12: 64,957,227 E171K probably damaging Het
Lrrfip2 T C 9: 111,223,972 I375T possibly damaging Het
Mccc1 T C 3: 35,979,017 N326S probably benign Het
Med13l T C 5: 118,593,550 V97A possibly damaging Het
Mertk C A 2: 128,784,000 T685K probably benign Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Myom2 G A 8: 15,083,310 V401M probably damaging Het
Nme5 A C 18: 34,578,685 M1R probably null Het
Nop2 T C 6: 125,133,763 S68P probably benign Het
Notch1 A T 2: 26,476,114 D809E possibly damaging Het
Olfr292 T C 7: 86,694,585 I43T possibly damaging Het
Ppat C T 5: 76,928,678 probably benign Het
Prss23 T A 7: 89,510,214 M216L probably benign Het
Psg18 A T 7: 18,349,354 V171D probably damaging Het
Psg28 A G 7: 18,427,891 V229A probably damaging Het
Qser1 T C 2: 104,787,831 N879D possibly damaging Het
Rpap1 T C 2: 119,770,041 N879S probably benign Het
Rusc2 T C 4: 43,415,926 S411P probably damaging Het
Rxfp2 T A 5: 150,067,360 W519R probably damaging Het
Scpep1 T A 11: 88,941,349 Q185L probably benign Het
Serpinb11 A G 1: 107,379,649 N270S probably benign Het
Skint10 T G 4: 112,727,672 I213L probably benign Het
Skint5 T C 4: 113,546,537 T1163A unknown Het
Slamf9 A T 1: 172,476,213 I42L possibly damaging Het
Slc1a3 T C 15: 8,650,846 probably benign Het
Smad6 T A 9: 63,953,900 Q371L possibly damaging Het
Snx31 A T 15: 36,555,324 V26E probably damaging Het
Taf4b A G 18: 14,822,172 N594S possibly damaging Het
Tanc2 T C 11: 105,780,092 S172P probably damaging Het
Tas2r110 T A 6: 132,868,475 Y156* probably null Het
Tbc1d20 G A 2: 152,293,936 probably benign Het
Timm50 A T 7: 28,306,859 D272E probably benign Het
Ttn T G 2: 76,900,511 probably benign Het
Vps13c T A 9: 67,916,379 F1362I probably benign Het
Vwf T C 6: 125,566,257 S154P probably benign Het
Zfp445 T C 9: 122,852,345 R844G probably benign Het
Other mutations in Serpinb6d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01482:Serpinb6d APN 13 33671363 missense probably benign 0.05
IGL01611:Serpinb6d APN 13 33666392 nonsense probably null
IGL01946:Serpinb6d APN 13 33671386 missense probably benign 0.22
IGL02672:Serpinb6d APN 13 33671389 missense probably benign 0.36
R0041:Serpinb6d UTSW 13 33667632 missense probably damaging 0.98
R0041:Serpinb6d UTSW 13 33667632 missense probably damaging 0.98
R1112:Serpinb6d UTSW 13 33669135 missense probably damaging 1.00
R1159:Serpinb6d UTSW 13 33671229 missense probably damaging 0.98
R1447:Serpinb6d UTSW 13 33670756 missense probably benign 0.42
R1608:Serpinb6d UTSW 13 33669129 missense probably benign
R1843:Serpinb6d UTSW 13 33671381 missense probably benign
R1945:Serpinb6d UTSW 13 33667680 missense possibly damaging 0.95
R2168:Serpinb6d UTSW 13 33666374 missense probably benign 0.08
R2275:Serpinb6d UTSW 13 33671428 missense probably benign 0.00
R3737:Serpinb6d UTSW 13 33667680 missense probably damaging 1.00
R3738:Serpinb6d UTSW 13 33667680 missense probably damaging 1.00
R3739:Serpinb6d UTSW 13 33667680 missense probably damaging 1.00
R3780:Serpinb6d UTSW 13 33664114 missense probably benign
R3782:Serpinb6d UTSW 13 33664114 missense probably benign
R4002:Serpinb6d UTSW 13 33670647 missense probably damaging 0.98
R4685:Serpinb6d UTSW 13 33671228 missense probably damaging 1.00
R4707:Serpinb6d UTSW 13 33671353 missense possibly damaging 0.83
R4761:Serpinb6d UTSW 13 33671267 missense probably damaging 1.00
R4859:Serpinb6d UTSW 13 33667564 splice site probably null
R4884:Serpinb6d UTSW 13 33666445 missense possibly damaging 0.76
R4951:Serpinb6d UTSW 13 33666383 missense probably benign 0.03
R5081:Serpinb6d UTSW 13 33671247 missense probably benign 0.32
R6726:Serpinb6d UTSW 13 33670735 missense probably benign 0.01
R6960:Serpinb6d UTSW 13 33671198 missense probably benign 0.08
R7214:Serpinb6d UTSW 13 33664145 missense probably damaging 1.00
R7732:Serpinb6d UTSW 13 33669099 missense probably benign 0.14
R8128:Serpinb6d UTSW 13 33666400 missense possibly damaging 0.46
R8197:Serpinb6d UTSW 13 33667605 missense probably damaging 0.98
Z1088:Serpinb6d UTSW 13 33671254 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- GACTGATGCCTTTGAGGAGG -3'
(R):5'- GGTAAAGCCTTTCCAAGAAACAGAC -3'

Sequencing Primer
(F):5'- AGGGCAGAGCAGACTTTTC -3'
(R):5'- GACAAATACTCAATTCCAAAGATGC -3'
Posted On2016-06-06